Transcript: Mouse NM_177267.4

Mus musculus DDB1 and CUL4 associated factor 5 (Dcaf5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dcaf5 (320808)
Length:
5707
CDS:
204..3044

Additional Resources:

NCBI RefSeq record:
NM_177267.4
NBCI Gene record:
Dcaf5 (320808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177267.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177984 GAGGAAATGATGAGCAAGTTA pLKO.1 559 CDS 100% 5.625 4.500 N Dcaf5 n/a
2 TRCN0000182067 CCAGTTTGACAATCAGGGTTA pLKO.1 1010 CDS 100% 4.050 3.240 N Dcaf5 n/a
3 TRCN0000198936 GCTGTGTCAATGCCATTGAAT pLKO.1 364 CDS 100% 5.625 3.938 N Dcaf5 n/a
4 TRCN0000200271 CCATCAGCAAAGACCTGTGAA pLKO.1 3402 3UTR 100% 4.950 3.465 N Dcaf5 n/a
5 TRCN0000198866 GAGTCCGATTCTGAAGAGAAT pLKO.1 1791 CDS 100% 0.495 0.347 N Dcaf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177267.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11308 pDONR223 100% 31.2% 30.9% None (many diffs) n/a
2 ccsbBroad304_11308 pLX_304 0% 31.2% 30.9% V5 (many diffs) n/a
3 TRCN0000469590 ATCGCCAGACCCGGACCTCCCGAG pLX_317 44.9% 31.2% 30.9% V5 (many diffs) n/a
Download CSV