Construct: ORF TRCN0000469616
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006623.1_s317c1
- Derived from:
- ccsbBroadEn_12004
- DNA Barcode:
- CAGTGATACCCTATTGCCGTCGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CDK5RAP1 (51654)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469616
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | NM_001278168.1 | 99.8% | 99.8% | 432A>G;638G>A |
| 2 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | NM_016408.4 | 86.7% | 86.7% | 432A>G;638G>A;875_1105del |
| 3 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | NM_001278167.1 | 86.5% | 86.5% | (many diffs) |
| 4 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | NM_001365728.1 | 84.7% | 84.6% | 432A>G;638G>A;875_1147del |
| 5 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | NM_016082.4 | 81.3% | 79.7% | (many diffs) |
| 6 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | NM_001278169.1 | 78.8% | 74.1% | (many diffs) |
| 7 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XR_001754289.2 | 70.4% | (many diffs) | |
| 8 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_011528857.2 | 68% | 67.9% | (many diffs) |
| 9 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_011528856.3 | 66.8% | 62.4% | (many diffs) |
| 10 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XR_001754290.2 | 66.8% | (many diffs) | |
| 11 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_011528858.1 | 65.1% | 63.7% | (many diffs) |
| 12 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_011528859.2 | 65.1% | 63.7% | (many diffs) |
| 13 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_024451892.1 | 55.6% | 55.5% | 0_1ins549;89G>A;326_556del |
| 14 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_024451893.1 | 55.6% | 55.5% | 0_1ins549;89G>A;326_556del |
| 15 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_024451894.1 | 55.6% | 55.5% | 0_1ins549;89G>A;326_556del |
| 16 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_024451895.1 | 55.6% | 55.5% | 0_1ins549;89G>A;326_556del |
| 17 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_017027877.1 | 53.9% | 45% | (many diffs) |
| 18 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_011528860.1 | 43.6% | 43.6% | 0_1ins762;113_343del |
| 19 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_017027876.2 | 43.6% | 43.6% | 0_1ins762;113_343del |
| 20 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_024451896.1 | 43.6% | 43.6% | 0_1ins762;113_343del |
| 21 | human | 51654 | CDK5RAP1 | CDK5 regulatory subunit ass... | XM_024451897.1 | 43.6% | 43.6% | 0_1ins762;113_343del |
| 22 | mouse | 66971 | Cdk5rap1 | CDK5 regulatory subunit ass... | NM_025876.2 | 73.7% | 75.2% | (many diffs) |
| 23 | mouse | 66971 | Cdk5rap1 | CDK5 regulatory subunit ass... | XR_001783168.1 | 61.7% | (many diffs) | |
| 24 | mouse | 66971 | Cdk5rap1 | CDK5 regulatory subunit ass... | XR_001783167.1 | 47.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1596
- ORF length:
- 1530
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ccctttacag tgtgtcctcc aagtgcagag gtctctgggg tggggaccat 121 tggcctctgt gtcttggctg tcgctgagga tgtgcagggc acacagcagt ctctctagta 181 ccatgtgtcc cagtccagag aggcaggagg atggagctcg gaaggatttc agctccaggc 241 tggctgctgg accgactttt caacattttt taaaaagtgc ctcagctcct caggagaagc 301 tgtcttcaga agtggaagac ccacctccct atctcatgat ggatgaactt cttggaaggc 361 agagaaaagt ctacctcgag acctatggct gccagatgaa tgtgaatgac acagagatag 421 cctggtccat cttacagaag agtggctacc tgcggaccag taacctccaa gaggcagatg 481 tgattctcct tgtcacgtgc tctatcaggg agaaggctga gcagaccatc tggaaccgtt 541 tacatcagct taaagccttg aagacaaggc ggccccgctc ccgggttcct ctgaggattg 601 gaattctagg ctgcatggct gagaggttga aggaggagat tctcaacaga gagaaaatgg 661 tagatatttt ggctggtcct gatgcctacc gggaccttcc ccagctgctg gctgttgctg 721 agtcgggcca gcaagctgcc aacgtgctgc tctctctgga cgagacctat gctgatgtca 781 tgccagtcca gacaagcgcc agtgccacgt ctgcctttgt gtcaatcatg cgaggctgtg 841 acaacatgtg tagctactgc attgttcctt tcacccgggg cagggagagg agtcggccta 901 ttgcctccat tctagaggaa gtgaagaagc tttctgagca ggttctgcag ctgattcatg 961 agagagataa catctgtaaa cagatccacc tgccagccca gagtggaagc agccgtgtgt 1021 tggaggccat gcggagggga tattcaagag aagcttatgt ggagttagtt caccatatta 1081 gagaatctat tccaggtgtg agcctcagca gcgatttcat tgctggcttt tgtggtgaga 1141 cggaggaaga tcacgtccag acagtctctt tgctccggga agttcagtac aacatgggct 1201 tcctctttgc cTACAGCATG AGACAGAAGA CACGGGCATA TCATAGGCTG AAGGATGATG 1261 TCCCGGAAGA GGTAAAATTA AGGCGTTTGG AGGAACTCAT CACTATCTTC CGAGAAGAAG 1321 CAACAAAAGC CAATCAGACC TCTGTGGGCT GTACCCAGTT GGTGCTAGTG GAAGGGCTCA 1381 GTAAACGCTC TGCCACTGAC CTGTGTGGCA GGAATGATGG AAACCTTAAG GTGATCTTCC 1441 CTGATGCAGA GATGGAGGAT GTCAATAACC CTGGGCTCAG GGTCAGAGCC CAGCCTGGGG 1501 ACTATGTGCT GGTGAAGATC ACCTCAGCCA GTTCTCAGAC ACTTAGGGGA CATGTTCTCT 1561 GCAGGACCAC TCTGAGGGAC TCTTCTGCAT ATTGCTGCCC AACTTTCTTG TACAAAGTGG 1621 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1681 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1741 ACAGTGATAC CCTATTGCCG TCGAAACGCG TTAAGTCgac aatcaacctc tggattacaa 1801 aatttgtgaa agatt