Transcript: Human XM_017027876.2

PREDICTED: Homo sapiens CDK5 regulatory subunit associated protein 1 (CDK5RAP1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK5RAP1 (51654)
Length:
1878
CDS:
673..1674

Additional Resources:

NCBI RefSeq record:
XM_017027876.2
NBCI Gene record:
CDK5RAP1 (51654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233136 GGCTTTACCACCAACTATAAA pLKO_005 886 CDS 100% 15.000 21.000 N CDK5RAP1 n/a
2 TRCN0000247141 GGCTTTACCACCAACTATAAA pLKO_005 886 CDS 100% 15.000 21.000 N Cdk5rap1 n/a
3 TRCN0000370339 GACAGAAGACACGGGCATATC pLKO_005 1298 CDS 100% 10.800 15.120 N CDK5RAP1 n/a
4 TRCN0000056639 CCGGGAAGTTCAGTACAACAT pLKO.1 1251 CDS 100% 4.950 6.930 N CDK5RAP1 n/a
5 TRCN0000233137 TGGAGTTAGTTCACCATATTA pLKO_005 1136 CDS 100% 15.000 10.500 N CDK5RAP1 n/a
6 TRCN0000233135 ACCGTTTACATCAGCTTAAAG pLKO_005 591 5UTR 100% 13.200 9.240 N CDK5RAP1 n/a
7 TRCN0000056641 GTGGAGTTAGTTCACCATATT pLKO.1 1135 CDS 100% 13.200 9.240 N CDK5RAP1 n/a
8 TRCN0000377544 CACGTCCAGACAGTCTCTTTG pLKO_005 1228 CDS 100% 10.800 7.560 N CDK5RAP1 n/a
9 TRCN0000056638 CCAATCTCAGTCGTGGCTTTA pLKO.1 872 CDS 100% 10.800 7.560 N CDK5RAP1 n/a
10 TRCN0000056642 GAACCGTTTACATCAGCTTAA pLKO.1 589 5UTR 100% 10.800 7.560 N CDK5RAP1 n/a
11 TRCN0000233138 TGTGAGCCTCAGCAGCGATTT pLKO_005 1173 CDS 100% 10.800 7.560 N CDK5RAP1 n/a
12 TRCN0000233139 TCAGAGCTGACTTGGGCAATC pLKO_005 1690 3UTR 100% 6.000 4.200 N CDK5RAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08334 pDONR223 100% 56.7% 56.7% None 0_1ins762 n/a
2 ccsbBroad304_08334 pLX_304 0% 56.7% 56.7% V5 0_1ins762 n/a
3 TRCN0000471620 GGCATCTGGAACCAATTACATAAT pLX_317 28.1% 56.7% 56.7% V5 0_1ins762 n/a
4 ccsbBroadEn_12004 pDONR223 100% 43.6% 43.6% None 0_1ins762;113_343del n/a
5 ccsbBroad304_12004 pLX_304 0% 43.6% 43.6% V5 0_1ins762;113_343del n/a
6 TRCN0000469616 CAGTGATACCCTATTGCCGTCGAA pLX_317 25.4% 43.6% 43.6% V5 0_1ins762;113_343del n/a
Download CSV