Construct: ORF TRCN0000469624
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002738.1_s317c1
- Derived from:
- ccsbBroadEn_14648
- DNA Barcode:
- AGGCAGGCCTAAAATAGTCCCAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- FUT8 (2530)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469624
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_001371533.1 | 99.5% | 31.6% | (many diffs) |
2 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_001371534.1 | 99.5% | 31.6% | (many diffs) |
3 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_178155.3 | 99.5% | 31.6% | (many diffs) |
4 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_178156.2 | 99.5% | 31.6% | (many diffs) |
5 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_001371536.1 | 94% | 29.8% | (many diffs) |
6 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021136.1 | 94% | 29.8% | (many diffs) |
7 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021138.1 | 94% | 29.8% | (many diffs) |
8 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021139.1 | 94% | 29.8% | (many diffs) |
9 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_017021140.1 | 83.6% | 18.8% | (many diffs) |
10 | human | 2530 | FUT8 | fucosyltransferase 8 | NM_004480.4 | 71.3% | 3.4% | (many diffs) |
11 | human | 2530 | FUT8 | fucosyltransferase 8 | XM_011536614.3 | 59.6% | 10.2% | (many diffs) |
12 | human | 2530 | FUT8 | fucosyltransferase 8 | NR_038167.1 | 25% | (many diffs) | |
13 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_001252614.1 | 91.4% | 30.6% | (many diffs) |
14 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_016893.5 | 91.4% | 30.6% | (many diffs) |
15 | mouse | 53618 | Fut8 | fucosyltransferase 8 | XM_011244144.2 | 91.4% | 30.6% | (many diffs) |
16 | mouse | 53618 | Fut8 | fucosyltransferase 8 | XM_011244145.2 | 91.4% | 30.6% | (many diffs) |
17 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_001252615.1 | 65.2% | 3.4% | (many diffs) |
18 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NM_001252616.1 | 60.6% | 9.9% | (many diffs) |
19 | mouse | 53618 | Fut8 | fucosyltransferase 8 | NR_045554.1 | 47.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 627
- ORF length:
- 558
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcggccatgg actggttcct ggcgttggat tatgctcatt ctttttgcct 121 gggggacctt gctgttttat ataggtggtc acttggtacg agataatgac catcctgatc 181 actctagccg agaactgtcc aagattctgg caaagcttga acgcttaaaa cagcagaatg 241 aagacttgag gcgaatggcc gaatctctcc ggataccaga aggccctatt gatcaggggc 301 cagctatagg aagagtacgc gttttagaag agcagcttgt taaggccaaa gaacagattg 361 aaaattacaa gaaacagacc agaaatggtc tggggaagga tcatgaaatc ctgaggagga 421 ggattgaaaa tggagctaaa gagctctggt ttttcctaca gagtgaattg aagaaattaa 481 agaacttaga aggaaatgaa ctccaaagac atgcagatga atttcttttg gatttaggac 541 attatgaaag gtctataatg acggatctat actacctcag tcagacagat ggagcaggtg 601 attggcggga aaagaggcca aagatctgac agaactggtt cagcggagaa taacatatct 661 tcagaatccc aaggactgca gcaaagccaa aaagctggtg tgtaatatca acaaaggctg 721 tggctatggc tgtcagctcc atcatgtggt ctactgcttc atgattgcat atggcaccca 781 gcgaacactc atcttggaat ctcagaattg gcgctatgct actggtggat gggagactgt 841 atttaggcct gtaagtgaga catgcacaga cagatctggc atctccactg gacactggtc 901 aggtacagtg aaggacaaaa atgttcaagt ggtcgagctt cccattgtag acagtcttca 961 tccccgtcct ccatatttac ccttggctgt accagaagac ctcgcagatc gacttgtacg 1021 agtgcatggt gaccctgcag tgtggtgggt gtctcagttt gtcaaatact tgatccgccc 1081 acagccttgg ctagaaaaag aaatagaaga agccaccaag aagcttggct tcaaacatcc 1141 agttattgga gtccatgtca gacgcacaga caaagtggga acagaagctg ccttccatcc 1201 cattgaagag tacatggtgc atgttgaaga acattttcag cttcttgcac gcagaatgca 1261 agtggacaaa aaaagagtgt atttggccac agatgaccct tctttattaa aggaggcaaa 1321 aaccaggtac cccaattatg aatttattag tgataactct atttcctggt cagctggact 1381 gcacaatcga tacacagaaa attcacttcg tggagtgatc ctGGATATAC ATTTTCTCTC 1441 TCAGGCAGAC TTCCTAGTGT GTACTTTTTC ATCCCAGGTC TGTCGAGTTG CTTATGAAAT 1501 TATGCAAACA CTACATCCTG ATGCCTCTGC AAACTTCCAT TCTTTAGATG ACATCTACTA 1561 TTTTGGGGGC CAGAATGCCC ACAATCAAAT TGCCATTTAT GCTCACCAAC CCCGAACTGC 1621 AGATGAAATT CCCATGGAAC CTGGAGATAT CATTGGTGTG GCTGGAAATC ATTGGGATGG 1681 CTATTCTAAA GGTGTCAACA GGAAATTGGG AAGGACGGGC CTATATCCCT CCTACAAAGT 1741 TCGAGAGAAG ATAGAAACGG TCAAGTACCC CACATATCCT GAGGCTGAGA AATTGCCAAC 1801 TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA 1861 TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TTCTTGGCTT TATATATCTT 1921 GTGGAAAGGA CGAAGGCAGG CCTAAAATAG TCCCAACACG CGTTAAGTCg acaatcaacc 1981 tctggattac aaaatttgtg aaagatt