Transcript: Mouse NM_016893.5

Mus musculus fucosyltransferase 8 (Fut8), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fut8 (53618)
Length:
2923
CDS:
516..2243

Additional Resources:

NCBI RefSeq record:
NM_016893.5
NBCI Gene record:
Fut8 (53618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016893.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094048 GCTGGTGTGTAACATCAATAA pLKO.1 1142 CDS 100% 13.200 18.480 N Fut8 n/a
2 TRCN0000349474 GCTGGTGTGTAACATCAATAA pLKO_005 1142 CDS 100% 13.200 18.480 N Fut8 n/a
3 TRCN0000350104 TGGTCATTTGGTTCGAGATAA pLKO_005 593 CDS 100% 13.200 10.560 N Fut8 n/a
4 TRCN0000094045 CGAGATAATGACCACCCTGAT pLKO.1 606 CDS 100% 4.050 3.240 N Fut8 n/a
5 TRCN0000094047 GCGAACTTCCATTCTTTGGAT pLKO.1 1977 CDS 100% 3.000 2.400 N Fut8 n/a
6 TRCN0000317929 GCGAACTTCCATTCTTTGGAT pLKO_005 1977 CDS 100% 3.000 2.400 N Fut8 n/a
7 TRCN0000094044 GCCCATACACAGTACAATAAT pLKO.1 2418 3UTR 100% 15.000 10.500 N Fut8 n/a
8 TRCN0000318000 GCCCATACACAGTACAATAAT pLKO_005 2418 3UTR 100% 15.000 10.500 N Fut8 n/a
9 TRCN0000094046 CGCAGAATGCAAGTGGATAAA pLKO.1 1698 CDS 100% 13.200 9.240 N Fut8 n/a
10 TRCN0000317999 CGCAGAATGCAAGTGGATAAA pLKO_005 1698 CDS 100% 13.200 9.240 N Fut8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016893.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14648 pDONR223 76.1% 91.4% 30.6% None (many diffs) n/a
2 ccsbBroad304_14648 pLX_304 0% 91.4% 30.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469624 AGGCAGGCCTAAAATAGTCCCAAC pLX_317 21.8% 91.4% 30.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_10831 pDONR223 100% 49.8% 46% None (many diffs) n/a
5 ccsbBroad304_10831 pLX_304 0% 49.8% 46% V5 (many diffs) n/a
6 TRCN0000475794 GCAGACAGAAAGGTCGGGCGAGAA pLX_317 35.3% 49.8% 46% V5 (many diffs) n/a
Download CSV