Construct: ORF TRCN0000469650
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014871.1_s317c1
- Derived from:
- ccsbBroadEn_03808
- DNA Barcode:
- ATTGCAGCACATCCAGACATCGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ERGIC1 (57222)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469650
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 57222 | ERGIC1 | endoplasmic reticulum-golgi... | NM_001031711.3 | 100% | 100% | |
2 | human | 57222 | ERGIC1 | endoplasmic reticulum-golgi... | XM_011534597.1 | 91.8% | 90.1% | (many diffs) |
3 | human | 57222 | ERGIC1 | endoplasmic reticulum-golgi... | XM_024446135.1 | 68.2% | 68.2% | 0_1ins276 |
4 | human | 57222 | ERGIC1 | endoplasmic reticulum-golgi... | XR_001742159.2 | 29.5% | 1_27del;401_573del;1071_2940del | |
5 | mouse | 67458 | Ergic1 | endoplasmic reticulum-golgi... | NM_026170.3 | 90.9% | 98.9% | (many diffs) |
6 | mouse | 67458 | Ergic1 | endoplasmic reticulum-golgi... | XM_006524823.2 | 85.5% | 93.1% | (many diffs) |
7 | mouse | 67458 | Ergic1 | endoplasmic reticulum-golgi... | XM_006524824.1 | 42.4% | 33.1% | (many diffs) |
8 | mouse | 67458 | Ergic1 | endoplasmic reticulum-golgi... | XM_006524825.3 | 42.4% | 33.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ctttgacttc aggaggtttg acatctacag gaaggtgccc aaggacctta 121 cgcagccaac gtacaccggg gccattatct ccatctgctg ctgcctcttc atcctcttcc 181 tcttcctctc ggagctcacc ggatttataa cgacagaagt tgtgaacgag ctctatgtcg 241 atgacccaga caaggacagc ggtggcaaga tcgacgtcag tctgaacatc agtttaccca 301 atctgcactg cgagttggtt gggcttgaca ttcaggatga gatgggcagg cacgaagtgg 361 gccacatcga caactccatg aagatcccgc tgaacaatgg ggcaggctgc cgcttcgagg 421 ggcagttcag catcaacaag gtccccggca acttccacgt gtccacacac agtgccacag 481 cccagccaca gaacccagac atgacgcatg tcatccacaa gctctccttt ggggacacgc 541 tacaggtcca gaacatccac ggagctttca atgctctcgg GGGAGCAGAC AGACTCACCT 601 CCAACCCCCT GGCCTCCCAC GACTACATCC TGAAGATTGT GCCCACGGTT TATGAGGACA 661 AGAGTGGCAA GCAGCGGTAC TCCTACCAGT ACACGGTGGC CAACAAGGAA TACGTCGCCT 721 ACAGCCACAC GGGCCGCATC ATCCCTGCAA TCTGGTTCCG CTACGACCTC AGCCCCATCA 781 CGGTCAAGTA CACAGAGAGA CGGCAGCCGC TGTACAGATT CATCACCACG ATCTGTGCCA 841 TCATTGGCGG GACCTTCACC GTCGCCGGCA TCCTGGACTC ATGCATCTTC ACAGCCTCTG 901 AGGCCTGGAA GAAGATCCAG CTGGGCAAGA TGCATTGCCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 AATTGCAGCA CATCCAGACA TCGGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt