Transcript: Human XM_011534597.1

PREDICTED: Homo sapiens endoplasmic reticulum-golgi intermediate compartment 1 (ERGIC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERGIC1 (57222)
Length:
2827
CDS:
16..960

Additional Resources:

NCBI RefSeq record:
XM_011534597.1
NBCI Gene record:
ERGIC1 (57222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534597.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059429 CCACATCGACAACTCCATGAA pLKO.1 384 CDS 100% 4.950 3.465 N ERGIC1 n/a
2 TRCN0000059428 GCTTGACATTCAGGATGAGAT pLKO.1 345 CDS 100% 4.950 3.465 N ERGIC1 n/a
3 TRCN0000059431 CTGAACATCAGTTTACCCAAT pLKO.1 304 CDS 100% 4.050 2.835 N ERGIC1 n/a
4 TRCN0000059432 GCAGTTCAGCATCAACAAGGT pLKO.1 444 CDS 100% 2.640 1.848 N ERGIC1 n/a
5 TRCN0000247355 CCATGAAGATCCCGCTGAATA pLKO_005 398 CDS 100% 13.200 9.240 N Ergic1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534597.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03808 pDONR223 100% 91.8% 90.1% None (many diffs) n/a
2 ccsbBroad304_03808 pLX_304 0% 91.8% 90.1% V5 (many diffs) n/a
3 TRCN0000469650 ATTGCAGCACATCCAGACATCGGC pLX_317 41.1% 91.8% 90.1% V5 (many diffs) n/a
Download CSV