Construct: ORF TRCN0000469715
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001590.1_s317c1
- Derived from:
- ccsbBroadEn_01274
- DNA Barcode:
- CCCGATGCAATCTTACAAACAACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRELP (5549)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469715
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5549 | PRELP | proline and arginine rich e... | NM_002725.4 | 100% | 100% | |
| 2 | human | 5549 | PRELP | proline and arginine rich e... | NM_201348.2 | 100% | 100% | |
| 3 | mouse | 116847 | Prelp | proline arginine-rich end l... | NM_054077.4 | 86.5% | 89.5% | (many diffs) |
| 4 | mouse | 116847 | Prelp | proline arginine-rich end l... | XM_006529084.3 | 86.5% | 89.5% | (many diffs) |
| 5 | mouse | 116847 | Prelp | proline arginine-rich end l... | XM_006529085.3 | 86.5% | 89.5% | (many diffs) |
| 6 | mouse | 116847 | Prelp | proline arginine-rich end l... | XM_006529083.3 | 82.4% | 85.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1212
- ORF length:
- 1146
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gtcacccctc tgctggctcc tcccacttct catcttggcc tcagtggccc 121 aaggccagcc aacaagacga ccaagacccg ggactgggcc cgggcgcaga cccaggccca 181 ggcccaggcc cacacccagc tttcctcagc ctgatgaacc agcagagcca acagacctgc 241 ctcctcccct ccctccaggc cctccatcta tcttccctga ctgtccccgc gaatgctact 301 gcccccctga tttcccatct gccctctact gtgatagccg caacctgcga aaggtccctg 361 tcatcccgcc ccgcatccat tacctctatc tccagaacaa cttcatcact gagctcccgg 421 tggagtcctt ccagaatgcc acaggcctgc gatggattaa cctggacaac aaccgaatcc 481 gcaagataga ccagagggtg ctggagaaac tgcccggcct ggtgttcctc tacatggaga 541 agaaccagtt ggaagaggtc ccctcggccc tgccccggaa cctggagcag ctgaggctga 601 gccagaacca catctccaga atcccgcctg gtgtcttcag caagctggag aacctgctgc 661 tcctggatct ccagcacaac aggctgagcg acggcgtctt caagcccgac accttccatg 721 gcctcaagaa cctcatgcag ctcaacctgg cccacaacat ccTGAGAAAG ATGCCGCCCA 781 GGGTCCCCAC CGCCATTCAC CAGCTCTACC TGGACAGTAA CAAGATTGAG ACCATCCCTA 841 ACGGATACTT CAAGAGCTTT CCCAATCTTG CCTTCATTCG GCTTAACTAC AACAAGCTGA 901 CAGACAGGGG ACTCCCCAAG AACTCCTTTA ATATCTCCAA CCTGCTTGTG CTCCACCTGT 961 CCCACAACAG GATCAGCAGT GTGCCCGCCA TCAACAACAG GCTGGAACAC CTGTACCTCA 1021 ACAACAATAG CATCGAGAAA ATCAACGGAA CCCAGATTTG CCCCAACGAC CTAGTGGCGT 1081 TCCATGACTT CTCCTCGGAC CTGGAGAACG TGCCACACCT GCGCTACCTG CGGCTGGATG 1141 GAAACTACTT GAAGCCGCCC ATCCCGCTGG ACCTCATGAT GTGCTTCCGC CTCCTGCAGT 1201 CCGTGGTCAT CTACCCAACT ATCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1261 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1321 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCC GATGCAATCT TACAAACAAC 1381 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t