Transcript: Mouse XM_006529084.3

PREDICTED: Mus musculus proline arginine-rich end leucine-rich repeat (Prelp), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prelp (116847)
Length:
3524
CDS:
93..1229

Additional Resources:

NCBI RefSeq record:
XM_006529084.3
NBCI Gene record:
Prelp (116847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094461 CTACCTGGATAGCAACAAGAT pLKO.1 821 CDS 100% 4.950 6.930 N Prelp n/a
2 TRCN0000318135 CTACCTGGATAGCAACAAGAT pLKO_005 821 CDS 100% 4.950 6.930 N Prelp n/a
3 TRCN0000094463 CAACGGGTACTTCAAGGACTT pLKO.1 854 CDS 100% 4.050 5.670 N Prelp n/a
4 TRCN0000318064 CAACGGGTACTTCAAGGACTT pLKO_005 854 CDS 100% 4.050 5.670 N Prelp n/a
5 TRCN0000094459 CCACTTCATCTGCTCTCTATT pLKO.1 2066 3UTR 100% 13.200 9.240 N Prelp n/a
6 TRCN0000318137 CCACTTCATCTGCTCTCTATT pLKO_005 2066 3UTR 100% 13.200 9.240 N Prelp n/a
7 TRCN0000162750 CACCTGTACCTCAACAACAAT pLKO.1 1023 CDS 100% 5.625 3.938 N PRELP n/a
8 TRCN0000094460 CCGAATCCATTACCTTTACTT pLKO.1 386 CDS 100% 5.625 3.938 N Prelp n/a
9 TRCN0000094462 GTCTCACAACAAGATCAGCAA pLKO.1 974 CDS 100% 2.640 1.848 N Prelp n/a
10 TRCN0000318136 GTCTCACAACAAGATCAGCAA pLKO_005 974 CDS 100% 2.640 1.848 N Prelp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529084.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01274 pDONR223 100% 86.5% 89.5% None (many diffs) n/a
2 ccsbBroad304_01274 pLX_304 0% 86.5% 89.5% V5 (many diffs) n/a
3 TRCN0000469715 CCCGATGCAATCTTACAAACAACT pLX_317 39.4% 86.5% 89.5% V5 (many diffs) n/a
Download CSV