Transcript: Human NM_002725.4

Homo sapiens proline and arginine rich end leucine rich repeat protein (PRELP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PRELP (5549)
Length:
5769
CDS:
150..1298

Additional Resources:

NCBI RefSeq record:
NM_002725.4
NBCI Gene record:
PRELP (5549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162750 CACCTGTACCTCAACAACAAT pLKO.1 1092 CDS 100% 5.625 7.875 N PRELP n/a
2 TRCN0000158491 CATTCGGCTTAACTACAACAA pLKO.1 959 CDS 100% 4.950 6.930 N PRELP n/a
3 TRCN0000159965 CAGTAACAAGATTGAGACCAT pLKO.1 899 CDS 100% 2.640 3.696 N PRELP n/a
4 TRCN0000158950 GCTGGTTTCTTTCAAGTTTAA pLKO.1 3817 3UTR 100% 13.200 9.240 N PRELP n/a
5 TRCN0000164036 CGGTGTGAACAGGTCAAGAAT pLKO.1 4049 3UTR 100% 5.625 3.938 N PRELP n/a
6 TRCN0000159287 GCCTCTTAATTGCTCTAACAA pLKO.1 4454 3UTR 100% 5.625 3.938 N PRELP n/a
7 TRCN0000161205 GCTGGATGGAAACTACTTGAA pLKO.1 1217 CDS 100% 4.950 3.465 N PRELP n/a
8 TRCN0000163685 GCGATGGATTAACCTGGACAA pLKO.1 533 CDS 100% 4.050 2.835 N PRELP n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2670 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2671 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4277 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002725.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01274 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01274 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469715 CCCGATGCAATCTTACAAACAACT pLX_317 39.4% 100% 100% V5 n/a
Download CSV