Construct: ORF TRCN0000469719
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005275.1_s317c1
- Derived from:
- ccsbBroadEn_01137
- DNA Barcode:
- ATCACAACTTTAGTAACTCTTTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- P2RY6 (5031)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469719
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277204.1 | 100% | 100% | |
| 2 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277205.1 | 100% | 100% | |
| 3 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277206.1 | 100% | 100% | |
| 4 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277207.1 | 100% | 100% | |
| 5 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176796.2 | 100% | 100% | |
| 6 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176797.2 | 100% | 100% | |
| 7 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_176798.2 | 100% | 100% | |
| 8 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_005274022.3 | 100% | 100% | |
| 9 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_006718571.3 | 100% | 100% | |
| 10 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545077.2 | 100% | 100% | |
| 11 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545079.2 | 100% | 100% | |
| 12 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | XM_011545076.2 | 82.4% | 82.4% | 1_210del |
| 13 | human | 5031 | P2RY6 | pyrimidinergic receptor P2Y6 | NM_001277208.1 | 76.4% | 76.4% | 1_303del |
| 14 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | NM_183168.2 | 83.7% | 86.5% | (many diffs) |
| 15 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | XM_006507640.3 | 83.7% | 86.5% | (many diffs) |
| 16 | mouse | 233571 | P2ry6 | pyrimidinergic receptor P2Y... | XM_011241739.2 | 83.7% | 86.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1050
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga atgggacaat ggcacaggcc aggctctggg cttgccaccc accacctgtg 121 tctaccgcga gaacttcaag caactgctgc tgccacctgt gtattcggcg gtgctggcgg 181 ctggcctgcc gctgaacatc tgtgtcatta cccagatctg cacgtcccgc cgggccctga 241 cccgcacggc cgtgtacacc ctaaaccttg ctctggctga cctgctatat gcctgctccc 301 tgcccctgct catctacaac tatgcccaag gtgatcactg gccctttggc gacttcgcct 361 gccgcctggt ccgcttcctc ttctatgcca acctgcacgg cagcatcctc ttcctcacct 421 gcatcagctt ccagcgctac ctgggcatct gccacccgct ggccccctgg cacaaacgtg 481 ggggccgccg ggctgcctgg ctagtgtgtg tagccgtgtg gctggccgtg acaacccagt 541 gcctgcccac agccatcttc gctgccacag gcatccagcg taaccgcact gtctgctatg 601 acctcagccc gcctgccctg gccacccact atatgcccta tggcatggct ctcactgtca 661 tcggcttccT GCTGCCCTTT GCTGCCCTGC TGGCCTGCTA CTGTCTCCTG GCCTGCCGCC 721 TGTGCCGCCA GGATGGCCCG GCAGAGCCTG TGGCCCAGGA GCGGCGTGGC AAGGCGGCCC 781 GCATGGCCGT GGTGGTGGCT GCTGCCTTTG CCATCAGCTT CCTGCCTTTT CACATCACCA 841 AGACAGCCTA CCTGGCAGTG CGCTCGACGC CGGGCGTCCC CTGCACTGTA TTGGAGGCCT 901 TTGCAGCGGC CTACAAAGGC ACGCGGCCGT TTGCCAGTGC CAACAGCGTG CTGGACCCCA 961 TCCTCTTCTA CTTCACCCAG AAGAAGTTCC GCCGGCGACC ACATGAGCTC CTACAGAAAC 1021 TCACAGCCAA ATGGCAGAGG CAGGGTCGCT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1081 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGCC 1141 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATCAC 1201 AACTTTAGTA ACTCTTTAAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1261 tgaaagatt