Transcript: Human NM_001277208.1

Homo sapiens pyrimidinergic receptor P2Y6 (P2RY6), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-04-20
Taxon:
Homo sapiens (human)
Gene:
P2RY6 (5031)
Length:
2466
CDS:
57..1346

Additional Resources:

NCBI RefSeq record:
NM_001277208.1
NBCI Gene record:
P2RY6 (5031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014075 CCACTATATGCCCTATGGCAT pLKO.1 920 CDS 100% 0.264 0.370 N P2RY6 n/a
2 TRCN0000358039 CCCAAACCATGCGGAGAATTA pLKO_005 1413 3UTR 100% 13.200 9.240 N P2RY6 n/a
3 TRCN0000357968 CCTGGGCAGCCTTCATATTTG pLKO_005 1358 3UTR 100% 13.200 9.240 N P2RY6 n/a
4 TRCN0000367847 CTCTGGCTGACCTGCTATATG pLKO_005 565 CDS 100% 13.200 9.240 N P2RY6 n/a
5 TRCN0000014077 CCTCTTCTACTTCACCCAGAA pLKO.1 1256 CDS 100% 4.050 2.835 N P2RY6 n/a
6 TRCN0000014073 GCAGCCTTCATATTTGCCATT pLKO.1 1363 3UTR 100% 4.050 2.835 N P2RY6 n/a
7 TRCN0000014076 CATCTGTGTCATTACCCAGAT pLKO.1 491 CDS 100% 0.405 0.284 N P2RY6 n/a
8 TRCN0000358038 TGGTCCGCTTCCTCTTCTATG pLKO_005 661 CDS 100% 10.800 6.480 N P2RY6 n/a
9 TRCN0000014074 CCTACAGAAACTCACAGCCAA pLKO.1 1304 CDS 100% 2.640 1.584 N P2RY6 n/a
10 TRCN0000221269 CATCACCAAGACAGCCTACTT pLKO.1 1127 CDS 100% 4.950 3.465 N P2ry6 n/a
11 TRCN0000221268 CGCTTCCTCTTCTATGCCAAT pLKO.1 666 CDS 100% 4.050 2.835 N P2ry6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277208.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01137 pDONR223 100% 76.4% 76.4% None 1_303del n/a
2 ccsbBroad304_01137 pLX_304 0% 76.4% 76.4% V5 1_303del n/a
3 TRCN0000469719 ATCACAACTTTAGTAACTCTTTAA pLX_317 38.9% 76.4% 76.4% V5 1_303del n/a
4 TRCN0000489001 CCTGCGAGCTCTCCATCCGATTCC pLX_317 34.5% 76.4% 76.4% V5 (not translated due to prior stop codon) 1_303del n/a
5 TRCN0000489536 TACCCCGAACATCAAACAACACCA pLX_317 33.5% 76.3% 76.2% V5 1_303del;1287_1288insG n/a
Download CSV