Transcript: Mouse NM_183168.2

Mus musculus pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2ry6), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
P2ry6 (233571)
Length:
1917
CDS:
401..1387

Additional Resources:

NCBI RefSeq record:
NM_183168.2
NBCI Gene record:
P2ry6 (233571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413044 TGATTTGGCAACTGGTCAATT pLKO_005 1548 3UTR 100% 13.200 18.480 N P2ry6 n/a
2 TRCN0000426998 AGGATGTTGTGACAAGATAAC pLKO_005 1592 3UTR 100% 10.800 7.560 N P2ry6 n/a
3 TRCN0000221270 CATAGCCTTACTGGCTTGTTA pLKO.1 1015 CDS 100% 5.625 3.938 N P2ry6 n/a
4 TRCN0000221269 CATCACCAAGACAGCCTACTT pLKO.1 1168 CDS 100% 4.950 3.465 N P2ry6 n/a
5 TRCN0000413681 CCCTACTTATCTATAACTACG pLKO_005 639 CDS 100% 4.050 2.835 N P2ry6 n/a
6 TRCN0000221268 CGCTTCCTCTTCTATGCCAAT pLKO.1 707 CDS 100% 4.050 2.835 N P2ry6 n/a
7 TRCN0000439960 CACTGAACATCTGCGTCATTG pLKO_005 525 CDS 100% 10.800 6.480 N P2ry6 n/a
8 TRCN0000221267 CCTCCAGAATTTCCACATCAA pLKO.1 1507 3UTR 100% 4.950 2.970 N P2ry6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183168.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01137 pDONR223 100% 83.7% 86.5% None (many diffs) n/a
2 ccsbBroad304_01137 pLX_304 0% 83.7% 86.5% V5 (many diffs) n/a
3 TRCN0000469719 ATCACAACTTTAGTAACTCTTTAA pLX_317 38.9% 83.7% 86.5% V5 (many diffs) n/a
4 TRCN0000489001 CCTGCGAGCTCTCCATCCGATTCC pLX_317 34.5% 83.7% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489536 TACCCCGAACATCAAACAACACCA pLX_317 33.5% 83.6% 86.3% V5 (many diffs) n/a
Download CSV