Construct: ORF TRCN0000469754
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014175.1_s317c1
- Derived from:
- ccsbBroadEn_00186
- DNA Barcode:
- CAAACCACCATGTCCTCTCACAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C4BPB (725)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469754
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 725 | C4BPB | complement component 4 bind... | NM_001017364.1 | 100% | 100% | |
2 | human | 725 | C4BPB | complement component 4 bind... | NM_001017366.3 | 100% | 100% | |
3 | human | 725 | C4BPB | complement component 4 bind... | XM_024449464.1 | 100% | 100% | |
4 | human | 725 | C4BPB | complement component 4 bind... | NM_000716.3 | 99.6% | 99.6% | 58_60delGCA |
5 | human | 725 | C4BPB | complement component 4 bind... | NM_001017365.3 | 99.6% | 99.6% | 58_60delGCA |
6 | human | 725 | C4BPB | complement component 4 bind... | NM_001017367.1 | 99.6% | 99.6% | 58_60delGCA |
7 | human | 725 | C4BPB | complement component 4 bind... | XM_005273254.5 | 99.6% | 99.6% | 58_60delGCA |
8 | human | 725 | C4BPB | complement component 4 bind... | XM_005273255.2 | 71.1% | 57.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 819
- ORF length:
- 753
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tttttggtgt gcgtgctgtc ttatggttgc gtggcgagtt tctgcttcag 121 atgagcactg tccagagctt cctccagtgg acaatagcat atttgtcgca aaggaggtgg 181 aaggacagat tctggggact tacgtttgta tcaagggcta ccacctggta ggaaagaaga 241 cccttttttg caatgcctct aaggagtggg ataacaccac tactgagtgc cgcttgggcc 301 actgtcctga tcctgtgctg gtgaatggag agttcagttc ttcagggcct gtgaatgtaa 361 gtgacaaaat cacgtttatg tgcaatgacc actacatcct caagggcagc aatcggagcc 421 agtgtctaga ggaccacacc tgggcacctc cctttcccat cTGCAAAAGT AGGGACTGTG 481 ACCCTCCTGG GAATCCAGTT CATGGCTATT TTGAAGGAAA TAACTTCACC TTAGGATCCA 541 CCATTAGTTA TTACTGTGAA GACAGGTACT ACTTAGTGGG CGTGCAGGAG CAGCAATGCG 601 TTGATGGGGA GTGGAGCAGT GCACTTCCAG TCTGCAAGTT GATCCAGGAA GCTCCCAAAC 661 CAGAGTGTGA GAAGGCACTT CTTGCCTTTC AGGAGAGTAA GAACCTCTGC GAAGCCATGG 721 AGAACTTTAT GCAACAATTA AAGGAAAGTG GCATGACAAT GGAGGAGCTA AAATATTCTC 781 TGGAGCTGAA GAAAGCTGAG TTGAAGGCAA AATTGTTGTA CCCAACTTTC TTGTACAAAG 841 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 901 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 961 ACGACAAACC ACCATGTCCT CTCACAGAAC GCGTTAAGTC gacaatcaac ctctggatta 1021 caaaatttgt gaaagatt