Construct: ORF TRCN0000469832
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007227.1_s317c1
- Derived from:
- ccsbBroadEn_12871
- DNA Barcode:
- AATGATGTAGTCCGTCATCCTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LINGO1 (84894)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469832
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301186.1 | 100% | 100% | |
2 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301187.1 | 100% | 100% | |
3 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301189.2 | 100% | 100% | |
4 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301191.2 | 100% | 100% | |
5 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301192.2 | 100% | 100% | |
6 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301194.2 | 100% | 100% | |
7 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301195.2 | 100% | 100% | |
8 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301197.1 | 100% | 100% | |
9 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301198.1 | 100% | 100% | |
10 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301199.1 | 100% | 100% | |
11 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_001301200.2 | 100% | 100% | |
12 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | XM_011522118.2 | 100% | 100% | |
13 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | XM_017022682.1 | 100% | 100% | |
14 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | XM_024450091.1 | 100% | 100% | |
15 | human | 84894 | LINGO1 | leucine rich repeat and Ig ... | NM_032808.7 | 99% | 99% | 1_18del |
16 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | NM_181074.4 | 92% | 99.3% | (many diffs) |
17 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_006511088.3 | 92% | 99.3% | (many diffs) |
18 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_006511089.3 | 92% | 99.3% | (many diffs) |
19 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_006511090.3 | 92% | 99.3% | (many diffs) |
20 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_017313333.1 | 92% | 99.3% | (many diffs) |
21 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_017313334.1 | 92% | 99.3% | (many diffs) |
22 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_017313335.1 | 92% | 99.3% | (many diffs) |
23 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_017313336.1 | 92% | 99.3% | (many diffs) |
24 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | NM_001311076.1 | 91.1% | 98.3% | (many diffs) |
25 | mouse | 235402 | Lingo1 | leucine rich repeat and Ig ... | XM_006511086.2 | 87.3% | 94.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1908
- ORF length:
- 1842
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggcggggggc gtgaggagca tgcccagccc cctcctggcc tgctggcagc 121 ccatcctcct gctggtgctg ggctcagtgc tgtcaggctc ggccacgggc tgcccgcccc 181 gctgcgagtg ctccgcccag gaccgcgctg tgctgtgcca ccgcaagcgc tttgtggcag 241 tccccgaggg catccccacc gagacgcgcc tgctggacct aggcaagaac cgcatcaaaa 301 cgctcaacca ggacgagttc gccagcttcc cgcacctgga ggagctggag ctcaacgaga 361 acatcgtgag cgccgtggag cccggcgcct tcaacaacct cttcaacctc cggacgctgg 421 gtctccgcag caaccgcctg aagctcatcc cgctaggcgt cttcactggc ctcagcaacc 481 tgaccaagct ggacatcagc gagaacaaga tcgttatcct actggactac atgtttcagg 541 acctgtacaa cctcaagtca ctggaggttg gcgacaatga cctcgtctac atctctcacc 601 gcgccttcag cggcctcaac agcctggagc agctgacgct ggagaaatgc aacctgacct 661 ccatccccac cgaggcgctg tcccacctgc acggcctcat cgtcctgagg ctccggcacc 721 tcaacatcaa tgccatccgg gactactcct tcaagaggct gtaccgactc aaggtcttgg 781 agatctccca ctggccctac ttggacacca tgacacccaa ctgcctctac ggcctcaacc 841 tgacgtccct gtccatcaca cactgcaatc tgaccgctgt gccctacctg gccgtccgcc 901 acctagtcta tctccgcttc ctcaacctct cctacaaccc catcagcacc attgagggct 961 ccatgttgca tgagctgctc cggctgcagg agatccagct ggtgggcggg cagctggccg 1021 tggtggagcc ctatgccttc cgcggcctca actacctgcg cgtgctcaat gtctctggca 1081 accagctgac cacactggag gaatcagtct tccactcggt gggcaacctg gagacactca 1141 tcctggactc caacccgctg gcctgcgact gtcggctcct gtgggtgttc cggcgccgct 1201 ggcggctcaa cttcaaccgg cagcagccca cgtgcgccac gcccgagttt gtccagggca 1261 aggagttcaa ggacttccct gatgtgctac tgcccaacta cttcacctgc cgccgcgccc 1321 gcatccggga ccgcaaggcc cagcaggtgt ttgtggacga gggccacacg gtgcagtttg 1381 tgtgccgggc cgatggcgac ccgccgcccg ccatcctctg gctctcaccc cgaaagcacc 1441 tggtctcagc caagagcaat gggcggctca cagtcttccc tgatggcacg ctGGAGGTGC 1501 GCTACGCCCA GGTACAGGAC AACGGCACGT ACCTGTGCAT CGCGGCCAAC GCGGGCGGCA 1561 ACGACTCCAT GCCCGCCCAC CTGCATGTGC GCAGCTACTC GCCCGACTGG CCCCATCAGC 1621 CCAACAAGAC CTTCGCTTTC ATCTCCAACC AGCCGGGCGA GGGAGAGGCC AACAGCACCC 1681 GCGCCACTGT GCCTTTCCCC TTCGACATCA AGACCCTCAT CATCGCCACC ACCATGGGCT 1741 TCATCTCTTT CCTGGGCGTC GTCCTCTTCT GCCTGGTGCT GCTGTTTCTC TGGAGCCGGG 1801 GCAAGGGCAA CACAAAGCAC AACATCGAGA TCGAGTATGT GCCCCGAAAG TCGGACGCAG 1861 GCATCAGCTC CGCCGACGCG CCCCGCAAGT TCAACATGAA GATGATATGC CCAACTTTCT 1921 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1981 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 2041 GTGGAAAGGA CGAAATGATG TAGTCCGTCA TCCTCAAACG CGTTAAGTCg acaatcaacc 2101 tctggattac aaaatttgtg aaagatt