Transcript: Mouse XM_006511090.3

PREDICTED: Mus musculus leucine rich repeat and Ig domain containing 1 (Lingo1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lingo1 (235402)
Length:
4211
CDS:
1368..3212

Additional Resources:

NCBI RefSeq record:
XM_006511090.3
NBCI Gene record:
Lingo1 (235402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420812 ACACGCGGCAGAGTCAATAAT pLKO_005 3443 3UTR 100% 15.000 21.000 N LINGO1 n/a
2 TRCN0000174355 CGGCAGAGTCAATAATTCAAT pLKO.1 3448 3UTR 100% 5.625 7.875 N Lingo1 n/a
3 TRCN0000278640 CGGCAGAGTCAATAATTCAAT pLKO_005 3448 3UTR 100% 5.625 7.875 N Lingo1 n/a
4 TRCN0000176399 CAGTGAGAACAAGATCGTCAT pLKO.1 1799 CDS 100% 4.050 5.670 N Lingo1 n/a
5 TRCN0000278641 CAGTGAGAACAAGATCGTCAT pLKO_005 1799 CDS 100% 4.050 5.670 N Lingo1 n/a
6 TRCN0000426186 TGTAACTTGGGTTTCAATAAT pLKO_005 3494 3UTR 100% 15.000 10.500 N LINGO1 n/a
7 TRCN0000175194 CTCTGTAACTTGGGTTTCAAT pLKO.1 3491 3UTR 100% 5.625 3.938 N Lingo1 n/a
8 TRCN0000297207 CTCTGTAACTTGGGTTTCAAT pLKO_005 3491 3UTR 100% 5.625 3.938 N Lingo1 n/a
9 TRCN0000194069 GCTACGACATCTCAACATCAA pLKO.1 2012 CDS 100% 4.950 3.465 N Lingo1 n/a
10 TRCN0000278643 GCTACGACATCTCAACATCAA pLKO_005 2012 CDS 100% 4.950 3.465 N Lingo1 n/a
11 TRCN0000194603 CAACCTGACATCCCTATCCAT pLKO.1 2138 CDS 100% 3.000 2.100 N Lingo1 n/a
12 TRCN0000278709 CAACCTGACATCCCTATCCAT pLKO_005 2138 CDS 100% 3.000 2.100 N Lingo1 n/a
13 TRCN0000155622 CCGCAAGTTCAACATGAAGAT pLKO.1 3185 CDS 100% 4.950 2.970 N LINGO1 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 770 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511090.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12871 pDONR223 100% 92% 99.3% None (many diffs) n/a
2 ccsbBroad304_12871 pLX_304 0% 92% 99.3% V5 (many diffs) n/a
3 TRCN0000469832 AATGATGTAGTCCGTCATCCTCAA pLX_317 22.8% 92% 99.3% V5 (many diffs) n/a
4 ccsbBroadEn_12872 pDONR223 100% 91.8% 98.8% None (many diffs) n/a
5 ccsbBroad304_12872 pLX_304 0% 91.8% 98.8% V5 (many diffs) n/a
6 TRCN0000469736 CAGGGCGGACAGGCGCGGCTATTC pLX_317 22.8% 91.8% 98.8% V5 (many diffs) n/a
Download CSV