Construct: ORF TRCN0000469855
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012503.1_s317c1
- Derived from:
- ccsbBroadEn_06292
- DNA Barcode:
- CATGGCAACTCGATCCGACGCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GNAI2 (2771)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469855
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2771 | GNAI2 | G protein subunit alpha i2 | NM_002070.4 | 99.9% | 99.7% | 125G>T |
2 | human | 2771 | GNAI2 | G protein subunit alpha i2 | NM_001282620.2 | 92.1% | 89.8% | (many diffs) |
3 | human | 2771 | GNAI2 | G protein subunit alpha i2 | NM_001282619.2 | 90.8% | 88% | (many diffs) |
4 | human | 2771 | GNAI2 | G protein subunit alpha i2 | NM_001166425.2 | 89.2% | 88.7% | (many diffs) |
5 | human | 2771 | GNAI2 | G protein subunit alpha i2 | NM_001282617.1 | 85.3% | 85.3% | 0_1ins156 |
6 | human | 2771 | GNAI2 | G protein subunit alpha i2 | NM_001282618.2 | 77.1% | 77.1% | 0_1ins243 |
7 | mouse | 14678 | Gnai2 | guanine nucleotide binding ... | NM_008138.5 | 91.6% | 98% | (many diffs) |
8 | mouse | 14678 | Gnai2 | guanine nucleotide binding ... | XM_006511637.3 | 91.6% | 98% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1131
- ORF length:
- 1065
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg ctgcaccgtg agcgccgagg acaaggcggc ggccgagcgc tctaagatga 121 tcgacaagaa cctgcgggag gacggagaga aggcggcgcg ggaggtgaag ttgctgctgt 181 tgggtgctgt ggagtcaggg aagagcacca tcgtcaagca gatgaagatc atccacgagg 241 atggctactc cgaggaggaa tgccggcagt accgggcggt tgtctacagc aacaccatcc 301 agtccatcat ggccattgtc aaagccatgg gcaacctgca gatcgacttt gccgacccct 361 ccagagcgga cgacgccagg cagctatttg cactgtcctg caccgccgag gagcaaggcg 421 tgctccctga tgacctgtcc ggcgtcatcc ggaggctctg ggctgaccat ggtgtgcagg 481 cctgctttgg ccgctcaagg gaataccagc tcaacgactc agctgcctac tacctgaacg 541 acctggagcg tattgcacag agtgactaca tccccacaca gcaagatgtg ctacggaccc 601 gcgtaaagac cacggggatc gtggagacac acttcacctt caaggaccta cacttcaaga 661 tgtttgatgt gggtggtcag cggtctgagc ggAAGAAGTG GATCCACTGC TTTGAGGGCG 721 TCACAGCCAT CATCTTCTGC GTAGCCTTGA GCGCCTATGA CTTGGTGCTA GCTGAGGACG 781 AGGAGATGAA CCGCATGCAT GAGAGCATGA AGCTATTCGA TAGCATCTGC AACAACAAGT 841 GGTTCACAGA CACGTCCATC ATCCTCTTCC TCAACAAGAA GGACCTGTTT GAGGAGAAGA 901 TCACACACAG TCCCCTGACC ATCTGCTTCC CTGAGTACAC AGGGGCCAAC AAATATGATG 961 AGGCAGCCAG CTACATCCAG AGTAAGTTTG AGGACCTGAA TAAGCGCAAA GACACCAAGG 1021 AGATCTACAC GCACTTCACG TGCGCCACCG ACACCAAGAA CGTGCAGTTC GTGTTTGACG 1081 CCGTCACCGA TGTCATCATC AAGAACAACC TGAAGGACTG CGGCCTCTTC TGCCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGACATG GCAACTCGAT CCGACGCACT ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt