Transcript: Mouse XM_006511637.3

PREDICTED: Mus musculus guanine nucleotide binding protein (G protein), alpha inhibiting 2 (Gnai2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gnai2 (14678)
Length:
1849
CDS:
175..1242

Additional Resources:

NCBI RefSeq record:
XM_006511637.3
NBCI Gene record:
Gnai2 (14678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362507 TGTGTCGCCTTGAGCGCTTAT pLKO_005 847 CDS 100% 10.800 15.120 N Gnai2 n/a
2 TRCN0000054736 GAGGATCTAAATAAGCGCAAA pLKO.1 1099 CDS 100% 4.050 5.670 N Gnai2 n/a
3 TRCN0000362428 AGCAAGTTTGAGGATCTAAAT pLKO_005 1090 CDS 100% 13.200 9.240 N Gnai2 n/a
4 TRCN0000362429 CTTTGGCCGCTCACGAGAATA pLKO_005 594 CDS 100% 13.200 9.240 N Gnai2 n/a
5 TRCN0000362427 GCAACCTGCAGATCGACTTTG pLKO_005 440 CDS 100% 10.800 7.560 N Gnai2 n/a
6 TRCN0000054734 GCCGCTTACTACCTGAATGAT pLKO.1 631 CDS 100% 5.625 3.938 N Gnai2 n/a
7 TRCN0000054737 CTCACGAGAATACCAGCTCAA pLKO.1 603 CDS 100% 4.050 2.835 N Gnai2 n/a
8 TRCN0000054733 CCTGCTCATTCTCGTAGCTTT pLKO.1 1364 3UTR 100% 4.950 2.970 N Gnai2 n/a
9 TRCN0000054735 GAGGTGAAGTTGCTTCTGTTA pLKO.1 271 CDS 100% 4.950 2.970 N Gnai2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15430 pDONR223 0% 91.7% 98.3% None (many diffs) n/a
2 ccsbBroad304_15430 pLX_304 0% 91.7% 98.3% V5 (many diffs) n/a
3 TRCN0000472339 AGGAGGTGTGGACGTATTAATGCG pLX_317 43.2% 91.7% 98.3% V5 (many diffs) n/a
4 ccsbBroadEn_06292 pDONR223 100% 91.6% 98% None (many diffs) n/a
5 ccsbBroad304_06292 pLX_304 0% 91.6% 98% V5 (many diffs) n/a
6 TRCN0000469855 CATGGCAACTCGATCCGACGCACT pLX_317 41.3% 91.6% 98% V5 (many diffs) n/a
Download CSV