Construct: ORF TRCN0000469864
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018824.1_s317c1
- Derived from:
- ccsbBroadEn_15291
- DNA Barcode:
- TTGTGTCTGGGCTCAGCACACATC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PRPS1L1 (221823)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469864
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221823 | PRPS1L1 | phosphoribosyl pyrophosphat... | NM_175886.3 | 99.8% | 1.8% | 187A>N |
| 2 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_002764.4 | 92.1% | 1.5% | (many diffs) |
| 3 | human | 5631 | PRPS1 | phosphoribosyl pyrophosphat... | NM_001204402.1 | 31.9% | 4.3% | (many diffs) |
| 4 | mouse | 328099 | Prps1l3 | phosphoribosyl pyrophosphat... | NM_001037746.3 | 89.9% | 1.5% | (many diffs) |
| 5 | mouse | 19139 | Prps1 | phosphoribosyl pyrophosphat... | NM_021463.4 | 89.6% | 1.5% | (many diffs) |
| 6 | mouse | 75456 | Prps1l1 | phosphoribosyl pyrophosphat... | NM_029294.2 | 87.3% | 1.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 202
- ORF end:
- 268
- ORF length:
- 66
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccac gccgaatatc aaaatcttca gcggcagctc ccaccaggac ttatcccaga 121 aaattgctga ccgcctgggc ctggagctag gcaaggtggt gactaagaaa ttcagcaacc 181 aggagacctg cgtggaaatt gatgagagtg tgcgtggaga ggatgtctac atcgttcaga 241 gtggttgtgg cgaantcaac gacagtctaa tggagctttt gatcatgatt aatgcctgca 301 agattgcttc agctagccga gttactgcag tcatcccatg cttcccttat gcccgacagg 361 ataagaagga taagagccgg tccccaatct ctgccaagct tgttgcaaat atgctctcta 421 tagcaggtgc ggatcatatc atcaccatgg acctacatgc ttctcaaatt cagggctttt 481 ttgatatccc agtagacaac ttgtatgcag agccaactgt cctgaagtgg ataagggaga 541 atatccctga gtggaagaac tgcattattg tctcgccaga tgctggtgga gctaaaagag 601 tgacctccat tgcagaccag ttgaatgtgg actttgcttt gattcataaa gaacggaaga 661 aggCCAATGA AGTGGACTGC ATAGTGCTAG TGGGAGATGT GAATGATCGT GTGGCTATCC 721 TTGTAGATGA CATGGCAGAC ACTTGTGTTA CAATCTGCCT CGCAGCTGAC AAACTTCTCT 781 CAGCTGGAGC AACCAGAGTT TATGCTATCT TGACTCATGG AATCTTTTCT GGCCCAGCCA 841 TTTCTCGCAT CAACACTGCA TGCTTTGAAG CAGTGGTAGT CACCAATACC ATACCTCAAG 901 ATGAGAAGAT GAAGCATTGC TCCAAAATAC GAGTAATTGA CATCTCCATG ATCCTTGCAG 961 AAGCCATAAG GAGAACTCAT AATGGGGAAT CTGTTTCCTA CCTGTTCAGC CATGTTCCTT 1021 TATTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGATT GTGTCTGGGC TCAGCACACA TCACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt