Construct: ORF TRCN0000469889
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003710.1_s317c1
- Derived from:
- BRDN0000394408
- DNA Barcode:
- AACATCTGGGTTTGGCACAAAACC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- TP73 (7161)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469889
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7161 | TP73 | tumor protein p73 | NM_005427.4 | 99.6% | 52.1% | (many diffs) |
| 2 | human | 7161 | TP73 | tumor protein p73 | NM_001126240.3 | 91.3% | 42.1% | (many diffs) |
| 3 | human | 7161 | TP73 | tumor protein p73 | NM_001204192.2 | 88.6% | 41.4% | (many diffs) |
| 4 | human | 7161 | TP73 | tumor protein p73 | NM_001204187.1 | 86.9% | 59.5% | (many diffs) |
| 5 | human | 7161 | TP73 | tumor protein p73 | NM_001204188.1 | 84.5% | 61.1% | (many diffs) |
| 6 | human | 7161 | TP73 | tumor protein p73 | NM_001204190.2 | 78.6% | 48% | (many diffs) |
| 7 | human | 7161 | TP73 | tumor protein p73 | NM_001204184.2 | 78.1% | 66% | (many diffs) |
| 8 | human | 7161 | TP73 | tumor protein p73 | NM_001204191.2 | 76.2% | 49.2% | (many diffs) |
| 9 | human | 7161 | TP73 | tumor protein p73 | NM_001204185.2 | 74.3% | 69.2% | (many diffs) |
| 10 | human | 7161 | TP73 | tumor protein p73 | NM_001126241.3 | 69.8% | 53.1% | (many diffs) |
| 11 | human | 7161 | TP73 | tumor protein p73 | NM_001126242.3 | 66% | 55.6% | (many diffs) |
| 12 | human | 7161 | TP73 | tumor protein p73 | NM_001204186.2 | 62.9% | 81.1% | (many diffs) |
| 13 | human | 7161 | TP73 | tumor protein p73 | NM_001204189.2 | 54.6% | 64.9% | (many diffs) |
| 14 | mouse | 22062 | Trp73 | transformation related prot... | NM_011642.3 | 83.5% | 47.1% | (many diffs) |
| 15 | mouse | 22062 | Trp73 | transformation related prot... | XM_006538720.2 | 82.1% | 46.3% | (many diffs) |
| 16 | mouse | 22062 | Trp73 | transformation related prot... | NM_001126330.1 | 79% | 42% | (many diffs) |
| 17 | mouse | 22062 | Trp73 | transformation related prot... | XM_006538721.2 | 76.7% | 40.6% | (many diffs) |
| 18 | mouse | 22062 | Trp73 | transformation related prot... | XM_006538722.3 | 76.7% | 40.6% | (many diffs) |
| 19 | mouse | 22062 | Trp73 | transformation related prot... | NM_001126331.1 | 66.2% | 49.4% | (many diffs) |
| 20 | mouse | 22062 | Trp73 | transformation related prot... | XM_006538723.2 | 58% | 20.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1164
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcccagtcc accgccctct cccctgatgg gggcaccacg tttgagcacc 121 tctggagctc tctggaacca gacagcacct acttcgacct tccccagtca agccggggga 181 ataatgaggt ggtgggcgga acggattcca gcatggacgt cttccacctg gagggcatga 241 ctacatctgt catggcccag ttcaatctgc tgagcagcac catggaccag atgagcagcc 301 gcgcggcctc ggccagcccc tacaccccag agcacgccgc cagcgtgccc acccactcgc 361 cctacgcaca acccagctcc accttcgaca ccatgtcgcc ggcgcctgtc atcccctcca 421 acaccgacta ccccggaccc caccactttg aggtcacttt ccagcagtcc agcacggcca 481 agtcagccac ctggacgtac tccccgctct tgaagaaact ctactgccag atcgccaaga 541 catgccccat ccagatcaag gtgtccaccc cgccaccccc aggcactgcc atccgggcca 601 tgcctgttta caagaaagcg gagcacgtga ccgacgtcgt gaaacgctgc cccaaccacg 661 agctcgggag ggacttcaac gaaggacagt ctgctccagc cagccacctc atccgcgtgg 721 aaggcaataa tctctcgcag tatgtggatg accctgtcac cggcaggcag agcgtcgtgg 781 tgccctatga gccaccacag gtggggacgg aattcaccac catcctgtac aacttcatgt 841 gtaacagcag ctgtgtaggg ggcatgaacc ggcggcccat cctcatcatc atcaccctgg 901 agatgcggga tgggcaggtg ctgggccgcc ggtcctttga gggccgcatc tgcgcctgtc 961 ctggccgcga ccgaaaagct gatgaggacc actaccggga gcagcaggcc ctgaacgaga 1021 gctccgccaa gaacggggcc gccagcaagc gtgccttcaa gcagagcccc cctgcagtca 1081 accgcccttg gtgccggtgt gaagaagcgg cggcatggag acgaggacac gtactacctt 1141 caggtgcgag gccgggagaa ctttgagatc ctgatgaagc tgaaagagag cctggagctg 1201 atggagttgg tgccgcagcc actggtggac tcctatcggc agcagcagca gctcctacag 1261 aggccgagtc acctacagcc cccgtcctac gggccggtcc tctcgcccat gaacaaggtg 1321 cacgggggca tgaacaagct gccctccgtc aaccagctgg tgggccagcc tcccccgcac 1381 agttcggcag ctacacccaa cctggggccc gtgggccccg ggatgctcaa caaccatggc 1441 cacgcagtgc cagccaacgg cgagatgagc agcagccaca gcgcccagtc catggtctcg 1501 gggtcccact gcactccgcc acccccctac cacgccgacc ccagcctcgt cagtttttta 1561 acaggattgg ggtgtccaaa ctgcatcgag tatttcacct cccaagggtt acagagcatt 1621 taccacctgc agaacctgac cattgaggac cTGGGGGCCC TGAAGATCCC CGAGCAGTAC 1681 CGCATGACCA TCTGGCGGGG CCTGCAGGAC CTGAAGCAGG GCCACGACTA CAGCACCGCG 1741 CAGCAGCTGC TCCGCTCTAG CAACGCGGCC ACCATCTCCA TCGGCGGCTC AGGGGAACTG 1801 CAGCGCCAGC GGGTCATGGA GGCCGTGCAC TTCCGCGTGC GCCACACCAT CACCATCCCC 1861 AACCGCGGCG GCCCAGGCGG CGGCCCTGAC GAGTGGGCGG ACTTCGGCTT CGACCTGCCC 1921 GACTGCAAGG CCCGCAAGCA GCCCATCAAG GAGGAGTTCA CGGAGGCCGA GATCCACTTG 1981 CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT 2041 CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT 2101 TATATATCTT GTGGAAAGGA CGAAACATCT GGGTTTGGCA CAAAACCACG CGTTAAGTCg 2161 acaatcaacc tctggattac aaaatttgtg aaagatt