Transcript: Human NM_001204187.1

Homo sapiens tumor protein p73 (TP73), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TP73 (7161)
Length:
4911
CDS:
111..1778

Additional Resources:

NCBI RefSeq record:
NM_001204187.1
NBCI Gene record:
TP73 (7161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272525 ATCCGCGTGGAAGGCAATAAT pLKO_005 753 CDS 100% 15.000 10.500 N TP73 n/a
2 TRCN0000006510 CCCACCACTTTGAGGTCACTT pLKO.1 481 CDS 100% 4.950 3.465 N TP73 n/a
3 TRCN0000006508 CCCGCTCTTGAAGAAACTCTA pLKO.1 545 CDS 100% 4.950 3.465 N TP73 n/a
4 TRCN0000272526 CCCGCTCTTGAAGAAACTCTA pLKO_005 545 CDS 100% 4.950 3.465 N TP73 n/a
5 TRCN0000006507 CTCTCCTTCCTGTGTGTCCAA pLKO.1 1833 3UTR 100% 2.640 1.848 N TP73 n/a
6 TRCN0000272527 CTCTCCTTCCTGTGTGTCCAA pLKO_005 1833 3UTR 100% 2.640 1.848 N TP73 n/a
7 TRCN0000284787 CTGTCATGGCCCAGTTCAATC pLKO_005 289 CDS 100% 10.800 6.480 N TP73 n/a
8 TRCN0000430928 AGTCAGCCACCTGGACGTATT pLKO_005 523 CDS 100% 10.800 6.480 N Trp63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469889 AACATCTGGGTTTGGCACAAAACC pLX_317 17.4% 86.9% 59.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV