Construct: ORF TRCN0000469938
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007351.1_s317c1
- Derived from:
- ccsbBroadEn_13296
- DNA Barcode:
- AGCGGTATATCAGTGAATTCAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IQUB (154865)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469938
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_005250162.5 | 49.2% | 49.2% | 1120_2274del |
| 2 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NM_001282855.1 | 47.1% | 47.1% | 1120_2373del |
| 3 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NM_001321293.1 | 47.1% | 47.1% | 1120_2373del |
| 4 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NM_178827.5 | 47.1% | 47.1% | 1120_2373del |
| 5 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_005250161.3 | 47.1% | 47.1% | 1120_2373del |
| 6 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_011515833.2 | 47.1% | 47.1% | 1120_2373del |
| 7 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_011515834.3 | 47.1% | 47.1% | 1120_2373del |
| 8 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | XM_017011771.1 | 47.1% | 47.1% | 1120_2373del |
| 9 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NR_104245.1 | 38% | 1_177del;1297_2939del | |
| 10 | human | 154865 | IQUB | IQ motif and ubiquitin doma... | NR_104244.1 | 33.9% | 1_164del;1284_3298del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1185
- ORF length:
- 1119
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc taatcaacag gagaagtatg aagctcagaa tatagtcaat tcaacagaag 121 agagtgatga tgcttttgat actgtcacta ttccagttcc ctcagaagag cctcaagagt 181 cagatcaaac tgaagagcat gaatctggaa tagaacaatt cagtgagagc catgcaatac 241 atgttgagga gcagagtgac caaagctttt caagcctgga accagacaat gaacaactca 301 tggaagaggt tatatcacca agacaagttt catatactcc gcaacatcat gaaaagcaat 361 atgcaatgca gaggccaaat gatgatagtt tggcatttct ggataaaata aagtctgtaa 421 aggaatcttt gcaagaatca gtggaagatt ctctagcaac agtaaaagtt gtacttattc 481 cagtgggcca ggaaattgta atacctttta aggttgatac cattcttaaa tatcttaagg 541 accatttttc acacttatta ggtatcccac attctgtact gcagataaga tactcaggaa 601 aaattcttaa aaataatgag actctagtac aacatggagt taagccacag gaaattgtac 661 aagtggaaat cttttctaca aaTCCAGATC TGTATCCAGT CAGAAGAATA GATGGATTAA 721 CTGATGTCTC TCAAATCATA ACTGTCACTG TCCAAACTGG ACTTGATCAA TACCAGCAGG 781 TACCTGTTGA GATTGTCAAA TCTGACTTTC ACAAACCATT TCTTGGTGGA TTCAGACATA 841 AAGTAACAGG AGTAGAGTAT CACAATGCTG GAACACAAAC TGTACCTAAA AGGATTCCCG 901 AAAGACTCAG TATATTTTGT AGGGATACGC AGACAGTTTT TCAGAAAAAA AATCTCCAAC 961 AAACTACAAA TACAACATCC ACACAGATGA CTAACATTGG TGTATATGTA TCAAATATGA 1021 CTGATAAACT GGTAACACCA GGAAAGTATT TTTCAGCAGC AGAATACCAT GCTCAAAGAC 1081 TAAAGGCGGT GATAGTGATA CAGACTTACT ACAGGCAATG GCATGCTAAA ATCTTCGTAG 1141 AGAATTTAAG AAGACAGAAA AGCTTAAGAC TGGAATGGGA AACATACCCA ACTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA AGCGGTATAT CAGTGAATTC AAAAACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt