Transcript: Human XM_011515834.3

PREDICTED: Homo sapiens IQ motif and ubiquitin domain containing (IQUB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IQUB (154865)
Length:
2870
CDS:
410..2785

Additional Resources:

NCBI RefSeq record:
XM_011515834.3
NBCI Gene record:
IQUB (154865)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423356 ACTATCACCGGAGGCATAATC pLKO_005 1578 CDS 100% 13.200 18.480 N IQUB n/a
2 TRCN0000007797 CCGGTGTCGTAACTGCATTAA pLKO.1 2278 CDS 100% 13.200 18.480 N IQUB n/a
3 TRCN0000007799 CCTTATGATGAGAGGAGTCAA pLKO.1 2047 CDS 100% 4.950 6.930 N IQUB n/a
4 TRCN0000011201 GCAGCAGAATACCATGCTCAA pLKO.1 1400 CDS 100% 4.050 5.670 N IQUB n/a
5 TRCN0000007796 GCCAGGAAATTGTAATACCTT pLKO.1 831 CDS 100% 3.000 4.200 N IQUB n/a
6 TRCN0000428915 CAACTCATGGAAGAGGTTATA pLKO_005 638 CDS 100% 13.200 9.240 N IQUB n/a
7 TRCN0000007798 CCCGAAAGACTCAGTATATTT pLKO.1 1241 CDS 100% 15.000 9.000 N IQUB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05084 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05084 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478505 ATCCTTTAGGCCGACATAGAACCC pLX_317 13.5% 100% 100% V5 n/a
4 ccsbBroadEn_13296 pDONR223 100% 47.1% 47.1% None 1120_2373del n/a
5 TRCN0000469938 AGCGGTATATCAGTGAATTCAAAA pLX_317 45% 47.1% 47.1% V5 1120_2373del n/a
Download CSV