Transcript: Human NR_104245.1

Homo sapiens IQ motif and ubiquitin domain containing (IQUB), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
IQUB (154865)
Length:
2939
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104245.1
NBCI Gene record:
IQUB (154865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423356 ACTATCACCGGAGGCATAATC pLKO_005 1346 3UTR 100% 13.200 18.480 N IQUB n/a
2 TRCN0000007797 CCGGTGTCGTAACTGCATTAA pLKO.1 1870 3UTR 100% 13.200 18.480 N IQUB n/a
3 TRCN0000007799 CCTTATGATGAGAGGAGTCAA pLKO.1 1639 3UTR 100% 4.950 6.930 N IQUB n/a
4 TRCN0000011201 GCAGCAGAATACCATGCTCAA pLKO.1 1168 3UTR 100% 4.050 5.670 N IQUB n/a
5 TRCN0000007796 GCCAGGAAATTGTAATACCTT pLKO.1 599 3UTR 100% 3.000 4.200 N IQUB n/a
6 TRCN0000428915 CAACTCATGGAAGAGGTTATA pLKO_005 406 3UTR 100% 13.200 9.240 N IQUB n/a
7 TRCN0000007798 CCCGAAAGACTCAGTATATTT pLKO.1 1009 3UTR 100% 15.000 9.000 N IQUB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104245.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05084 pDONR223 100% 70.5% None 1_177del;1411_1412ins176;2375_2939del n/a
2 ccsbBroad304_05084 pLX_304 0% 70.5% V5 1_177del;1411_1412ins176;2375_2939del n/a
3 TRCN0000478505 ATCCTTTAGGCCGACATAGAACCC pLX_317 13.5% 70.5% V5 1_177del;1411_1412ins176;2375_2939del n/a
4 ccsbBroadEn_13296 pDONR223 100% 38% None 1_177del;1297_2939del n/a
5 TRCN0000469938 AGCGGTATATCAGTGAATTCAAAA pLX_317 45% 38% V5 1_177del;1297_2939del n/a
Download CSV