Transcript: Mouse XM_030250119.1

PREDICTED: Mus musculus SMC hinge domain containing 1 (Smchd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Smchd1 (74355)
Length:
6861
CDS:
742..6012

Additional Resources:

NCBI RefSeq record:
XM_030250119.1
NBCI Gene record:
Smchd1 (74355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030250119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216689 CACGACAGCTAACGCATATTT pLKO.1 1016 CDS 100% 15.000 21.000 N Smchd1 n/a
2 TRCN0000250980 CACGACAGCTAACGCATATTT pLKO_005 1016 CDS 100% 15.000 21.000 N Smchd1 n/a
3 TRCN0000250982 TGTTAGGAGACACCATTATTT pLKO_005 5480 CDS 100% 15.000 21.000 N Smchd1 n/a
4 TRCN0000253779 TGTTAGGAGACACCATTATTT pLKO_005 5480 CDS 100% 15.000 21.000 N SMCHD1 n/a
5 TRCN0000179315 GCAGGTGATGTAATACGCAAT pLKO.1 3175 CDS 100% 4.050 5.670 N Smchd1 n/a
6 TRCN0000250981 TGATAATCCTGGCAAGAATTT pLKO_005 6029 3UTR 100% 13.200 10.560 N Smchd1 n/a
7 TRCN0000258112 AGTGGCATGTATGAGTATTAT pLKO_005 581 5UTR 100% 15.000 10.500 N Smchd1 n/a
8 TRCN0000182933 CCATTGAAGCTATTCAACTTT pLKO.1 6076 3UTR 100% 0.563 0.394 N Smchd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030250119.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11724 pDONR223 100% 13.1% 12.9% None (many diffs) n/a
2 ccsbBroad304_11724 pLX_304 0% 13.1% 12.9% V5 (many diffs) n/a
3 TRCN0000469964 CCTGCTGATGTGTGGTGATTCTCT pLX_317 54.2% 13.1% 12.9% V5 (many diffs) n/a
Download CSV