Construct: ORF TRCN0000469975
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005046.1_s317c1
- Derived from:
- ccsbBroadEn_14367
- DNA Barcode:
- AAGGTTCTCCTTAATAGGATCCTG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC8 (123016)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469975
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_001288781.1 | 99.9% | 99.2% | 1581delT |
| 2 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_198309.3 | 95% | 94.3% | 593_594ins78;1503delT |
| 3 | human | 123016 | TTC8 | tetratricopeptide repeat do... | XM_011536433.2 | 94.6% | 93.9% | 1393_1394ins84;1497delT |
| 4 | human | 123016 | TTC8 | tetratricopeptide repeat do... | XM_011536434.2 | 94.2% | 93.5% | 458_459ins90;1491delT |
| 5 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_144596.3 | 93.2% | 92.6% | 112_141del;623_624ins78;1533delT |
| 6 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_001366535.2 | 89.7% | 89% | 593_594ins78;1315_1316ins84;1419delT |
| 7 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_198310.3 | 89.3% | 88.7% | 458_459ins90;503_504ins78;1413delT |
| 8 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_001366536.2 | 84.1% | 83.4% | (many diffs) |
| 9 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_001288782.1 | 58.9% | 57.8% | (many diffs) |
| 10 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NM_001288783.1 | 51.9% | 51.2% | 0_1ins765;816delT |
| 11 | human | 123016 | TTC8 | tetratricopeptide repeat do... | XM_024449477.1 | 51.9% | 51.2% | 0_1ins765;816delT |
| 12 | human | 123016 | TTC8 | tetratricopeptide repeat do... | NR_159362.2 | 29% | (many diffs) | |
| 13 | mouse | 76260 | Ttc8 | tetratricopeptide repeat do... | NM_029553.3 | 84.3% | 90.3% | (many diffs) |
| 14 | mouse | 76260 | Ttc8 | tetratricopeptide repeat do... | NM_198311.1 | 82.8% | 88.7% | (many diffs) |
| 15 | mouse | 76260 | Ttc8 | tetratricopeptide repeat do... | XM_017315241.1 | 47% | 49.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1659
- ORF length:
- 1593
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ctcggagatg gagccgctgc tcctggcctg gagctatttt aggcgcagga 121 agttccagct ctgcgccgat ctatgcacgc agatgctgga gaagtcccct tatgaccagg 181 cagcttggat cttaaaagca agagcgctaa cagaaatggt atacatagat gaaattgatg 241 tagatcagga aggaattgca gaaatgatgc tggatgaaaa tgctatagct caagttccac 301 gccctggaac gtctttgaaa ctccctggaa ctaatcagac aggagggcct agccaggccg 361 ttaggccaat cacacaagct ggaagaccca ttacaggttt cctcaggccc agcacgcaga 421 gtggaaggcc aggcactatg gaacaggcta tcagaacacc cagaaccgcc tacacagccc 481 gccctatcac cagctcctcc ggaagatttg tcaggctggg aacggcttcc atgcttacaa 541 gtcctgatgg accatttata aatttatcta ggctgaattt aacaaagtat tcccagaaac 601 ctaagttggc aaaggctttg tttgagtata tctttcatca tgaaaatgat gttaagacta 661 ttcatcttga agatgtagtt ctacatcttg gaatttaccc attcttattg aggaataaaa 721 atcacattga aaaaaatgct ttggatctgg ctgccctctc cacagaacat tctcagtaca 781 aggactggtg gtggaaagta cagattggaa aatgttacta caggttggga atgtatcgtg 841 aagcagaaaa acagtttaaa tcagccctga agcagcagga aatggtagat acatttctgt 901 acttggcaaa agtttatgtc tcattggatc aacctgtgac tgctttaaat cttttcaaac 961 aaggcttaga taagtttcca ggagaagtaa ccctgctctg tggaattgca agaatctatg 1021 aggaaatgaa caatatgtca tcagcagcag aatattacaa agaagttttg aaacaagaca 1081 atactcatgt ggaagccatc gcatgcattg gaagcaacca cttctattct gatcagccag 1141 aaatagctct ccggttttac aggcggctgc tgcagatggg catttataac ggccagcttt 1201 ttaaCAATCT GGGGCTGTGT TGCTTCTATG CCCAGCAGTA TGATATGACT CTGACCTCAT 1261 TTGAACGTGC CCTTTCTTTG GCTGAAAATG AAGAAGAGGC AGCTGATGTC TGGTACAACT 1321 TGGGACATGT AGCTGTGGGA ATAGGAGATA CAAATTTGGC CCATCAGTGC TTCAGGCTGG 1381 CTCTGGTCAA CAACAACAAC CACGCCGAGG CCTACAACAA CCTGGCTGTG CTGGAGATGC 1441 GGAAGGGCCA CGTTGAACAG GCAAGGGCAC TATTACAAAC TGCATCATCA TTAGCACCCC 1501 ATATGTATGA ACCGCATTTT AATTTTGCAA CAATCTCTGA TAAGATTGGA GATCTGCAGA 1561 GAAGCTATGT TGCTGCGCAG AAGTCTGAAG CAGCATTTCC AGACCATGTG GACACACAAC 1621 ATTTAATTAA ACAATTAAGG CAGCATTTGC TATGCTCTGC CCAACTTTCT TGTACAAAGT 1681 GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG 1741 AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA 1801 CGAAAGGTTC TCCTTAATAG GATCCTGACG CGTTAAGTCg acaatcaacc tctggattac 1861 aaaatttgtg aaagatt