Transcript: Human NR_159362.2

Homo sapiens tetratricopeptide repeat domain 8 (TTC8), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-08-01
Taxon:
Homo sapiens (human)
Gene:
TTC8 (123016)
Length:
5304
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159362.2
NBCI Gene record:
TTC8 (123016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082931 CCAGAAACCTAAGTTGGCAAA pLKO.1 585 3UTR 100% 4.050 5.670 N TTC8 n/a
2 TRCN0000082928 CCTCATTTGAACGTGCCCTTT pLKO.1 1229 3UTR 100% 4.050 5.670 N TTC8 n/a
3 TRCN0000082930 CCCATATGTATGAACCGCATT pLKO.1 1472 3UTR 100% 0.000 0.000 N TTC8 n/a
4 TRCN0000422021 AGTCCTGATGGACCATTTATA pLKO_005 532 3UTR 100% 15.000 12.000 N TTC8 n/a
5 TRCN0000425230 GCGCTAACAGAAATGGTATAC pLKO_005 196 3UTR 100% 10.800 8.640 N TTC8 n/a
6 TRCN0000431487 GGTGGAGGTGGGAGGATTATA pLKO_005 2086 3UTR 100% 15.000 10.500 N TTC8 n/a
7 TRCN0000420539 CCTGTCCTTGATATTAGTTAA pLKO_005 1743 3UTR 100% 13.200 9.240 N TTC8 n/a
8 TRCN0000430964 GAACAGGCAAGGGCACTATTA pLKO_005 1429 3UTR 100% 13.200 9.240 N TTC8 n/a
9 TRCN0000424811 TCTATGAGGAAATGAACAATA pLKO_005 989 3UTR 100% 13.200 9.240 N TTC8 n/a
10 TRCN0000082932 CGCCGATCTATGCACGCAGAT pLKO.1 126 3UTR 100% 1.350 0.945 N TTC8 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4086 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14367 pDONR223 100% 29% None (many diffs) n/a
2 ccsbBroad304_14367 pLX_304 0% 29% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000469975 AAGGTTCTCCTTAATAGGATCCTG pLX_317 28.7% 29% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV