Transcript: Mouse NM_198311.1

Mus musculus tetratricopeptide repeat domain 8 (Ttc8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ttc8 (76260)
Length:
2287
CDS:
59..1606

Additional Resources:

NCBI RefSeq record:
NM_198311.1
NBCI Gene record:
Ttc8 (76260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082932 CGCCGATCTATGCACGCAGAT pLKO.1 127 CDS 100% 1.350 1.890 N TTC8 n/a
2 TRCN0000113213 CGTGGACACACAGCACTTAAT pLKO.1 1552 CDS 100% 13.200 10.560 N Ttc8 n/a
3 TRCN0000331947 CGTGGACACACAGCACTTAAT pLKO_005 1552 CDS 100% 13.200 10.560 N Ttc8 n/a
4 TRCN0000113214 CCAGGATCTATGAGGAAATGA pLKO.1 954 CDS 100% 5.625 3.938 N Ttc8 n/a
5 TRCN0000309519 CCAGGATCTATGAGGAAATGA pLKO_005 954 CDS 100% 5.625 3.938 N Ttc8 n/a
6 TRCN0000113210 CCGAACCTGTTGTCTGAACTT pLKO.1 1728 3UTR 100% 4.950 3.465 N Ttc8 n/a
7 TRCN0000309518 CCGAACCTGTTGTCTGAACTT pLKO_005 1728 3UTR 100% 4.950 3.465 N Ttc8 n/a
8 TRCN0000113212 GCTGAAATGATCCTGGATGAA pLKO.1 281 CDS 100% 4.950 3.465 N Ttc8 n/a
9 TRCN0000309521 GCTGAAATGATCCTGGATGAA pLKO_005 281 CDS 100% 4.950 3.465 N Ttc8 n/a
10 TRCN0000113211 CCAGAAGCCTAAGTTGGCAAA pLKO.1 616 CDS 100% 4.050 2.835 N Ttc8 n/a
11 TRCN0000309520 CCAGAAGCCTAAGTTGGCAAA pLKO_005 616 CDS 100% 4.050 2.835 N Ttc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14367 pDONR223 100% 82.8% 88.7% None (many diffs) n/a
2 ccsbBroad304_14367 pLX_304 0% 82.8% 88.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000469975 AAGGTTCTCCTTAATAGGATCCTG pLX_317 28.7% 82.8% 88.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV