Construct: ORF TRCN0000470003
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009958.1_s317c1
- Derived from:
- ccsbBroadEn_00451
- DNA Barcode:
- CTGCCCGATTTTTGCCAAACAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DMRT1 (1761)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470003
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1761 | DMRT1 | doublesex and mab-3 related... | NM_021951.3 | 100% | 100% | |
| 2 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_006716732.1 | 99.7% | 99.7% | 819_821delGCA |
| 3 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_011517771.1 | 77.3% | 67.7% | (many diffs) |
| 4 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_011517770.1 | 77.1% | 67.6% | (many diffs) |
| 5 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_011517772.1 | 63.9% | 46.4% | (many diffs) |
| 6 | human | 1761 | DMRT1 | doublesex and mab-3 related... | NM_001363767.1 | 57.6% | 57.6% | 0_1ins474 |
| 7 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_017014375.1 | 57.6% | 48.6% | 535_536ins284;645_646ins190 |
| 8 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_011517773.3 | 57.4% | 57.4% | 0_1ins474;345_347delGCA |
| 9 | human | 1761 | DMRT1 | doublesex and mab-3 related... | XM_024447434.1 | 51.2% | 51.2% | 0_1ins546 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1185
- ORF length:
- 1119
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc caacgacgag gcattcagca agccctctac accgtcggaa gcccctcacg 121 cccccggggt accgccgcag ggcagagccg ggggctttgg caaagcgtct ggggcgctag 181 tgggggcggc cagcggctcg agcgccgggg gcagcagcag aggaggcggc tccggctccg 241 gggcgtcgga cctgggtgcc gggagcaaga agtccccgcg gctgcccaag tgcgcacgct 301 gcaggaacca cggctacgcc tcgccgctca agggccacaa gcgcttctgc atgtggcgcg 361 actgccagtg caagaagtgc aacctgatcg ccgagaggca gcgcgtgatg gccgcgcagg 421 tggccctgag aaggcagcag gcccaggagg aggaattggg tatcagccac cccatcccac 481 tgcccagtgc ggccgagctg cttgtcaaaa gagagaacaa tggcagtaac ccgtgcctca 541 tgactgagtg cagtggcacc tctcagccac cgccggccag tgtccccacc actgcagctt 601 cagagggacg tatggtcatc caggatattc ctgctgtcac cagcagaggg catgtggaga 661 acacacctga cctggtttca gactccacct actacagcag cttctaccag ccgtctctgt 721 ttccttatta caacaatcta tacaactgcc cgcagtactc catggccttg gctgctgatt 781 ctgcttctgg ggaggtggga aatcccctcg ggggatcccc tgtgaagaac agccTTCGGG 841 GCCTCCCCGG ACCTTATGTG CCTGGTCAGA CAGGAAACCA GTGGCAGATG AAGAACATGG 901 AGAACCGCCA TGCAATGAGC TCCCAGTACA GGATGCATTC TTACTACCCG CCTCCCTCTT 961 ACCTGGGCCA GAGCGTGCCC CAGTTCTTCA CTTTTGAGGA TGCTCCCTCT TACCCGGAAG 1021 CCAGGGCGAG CGTATTCTCG CCGCCCAGCA GTCAAGATTC TGGCTTGGTT TCCCTCTCGA 1081 GCAGCTCTCC TATTAGTAAC AAGAGCACAA AGGCAGTGCT TGAATGTGAG CCTGCGTCGG 1141 AGCCCAGCAG CTTCACAGTC ACTCCCGTCA TCGAGGAGGA CGAGTGCCCA ACTTTCTTGT 1201 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1261 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1321 GAAAGGACGA CTGCCCGATT TTTGCCAAAC AAGCACGCGT TAAGTCgaca atcaacctct 1381 ggattacaaa atttgtgaaa gatt