Transcript: Human NM_001363767.1

Homo sapiens doublesex and mab-3 related transcription factor 1 (DMRT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
DMRT1 (1761)
Length:
1986
CDS:
388..1035

Additional Resources:

NCBI RefSeq record:
NM_001363767.1
NBCI Gene record:
DMRT1 (1761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013780 CGTATGGTCATCCAGGATATT pLKO.1 457 CDS 100% 13.200 18.480 N DMRT1 n/a
2 TRCN0000013782 CGAGCAGCTCTCCTATTAGTA pLKO.1 926 CDS 100% 5.625 7.875 N DMRT1 n/a
3 TRCN0000013778 CCTCTAAATGAGTCATCTAAT pLKO.1 1344 3UTR 100% 13.200 10.560 N DMRT1 n/a
4 TRCN0000013781 GTCAAGATTCTGGCTTGGTTT pLKO.1 899 CDS 100% 4.950 3.960 N DMRT1 n/a
5 TRCN0000413882 AGTCTGCTAAATGGATATATT pLKO_005 1520 3UTR 100% 15.000 10.500 N DMRT1 n/a
6 TRCN0000013779 GCCGTCTCTGTTTCCTTATTA pLKO.1 558 CDS 100% 15.000 10.500 N DMRT1 n/a
7 TRCN0000413893 GTGCTTTACTCACGGAGTTTA pLKO_005 1236 3UTR 100% 13.200 9.240 N DMRT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00451 pDONR223 100% 57.6% 57.6% None 0_1ins474 n/a
2 ccsbBroad304_00451 pLX_304 0% 57.6% 57.6% V5 0_1ins474 n/a
3 TRCN0000470003 CTGCCCGATTTTTGCCAAACAAGC pLX_317 31.6% 57.6% 57.6% V5 0_1ins474 n/a
Download CSV