Transcript: Human XM_017014375.1

PREDICTED: Homo sapiens doublesex and mab-3 related transcription factor 1 (DMRT1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DMRT1 (1761)
Length:
1981
CDS:
193..840

Additional Resources:

NCBI RefSeq record:
XM_017014375.1
NBCI Gene record:
DMRT1 (1761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013782 CGAGCAGCTCTCCTATTAGTA pLKO.1 921 3UTR 100% 5.625 7.875 N DMRT1 n/a
2 TRCN0000013778 CCTCTAAATGAGTCATCTAAT pLKO.1 1339 3UTR 100% 13.200 10.560 N DMRT1 n/a
3 TRCN0000013781 GTCAAGATTCTGGCTTGGTTT pLKO.1 894 3UTR 100% 4.950 3.960 N DMRT1 n/a
4 TRCN0000413882 AGTCTGCTAAATGGATATATT pLKO_005 1515 3UTR 100% 15.000 10.500 N DMRT1 n/a
5 TRCN0000413893 GTGCTTTACTCACGGAGTTTA pLKO_005 1231 3UTR 100% 13.200 9.240 N DMRT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00451 pDONR223 100% 57.6% 48.6% None 535_536ins284;645_646ins190 n/a
2 ccsbBroad304_00451 pLX_304 0% 57.6% 48.6% V5 535_536ins284;645_646ins190 n/a
3 TRCN0000470003 CTGCCCGATTTTTGCCAAACAAGC pLX_317 31.6% 57.6% 48.6% V5 535_536ins284;645_646ins190 n/a
Download CSV