Construct: ORF TRCN0000470023
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007099.1_s317c1
- Derived from:
- ccsbBroadEn_11998
- DNA Barcode:
- TCCCGGCCGTTATCTAACACACTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HDAC7 (51564)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470023
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538481.1 | 28.9% | 28.9% | 1_2028del |
| 2 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538482.1 | 28.9% | 28.9% | 1_2028del |
| 3 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_001098416.4 | 28.9% | 28.9% | 1_2034del |
| 4 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_001308090.2 | 28.3% | 28.3% | 1_2094del |
| 5 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_015401.5 | 27.8% | 27.8% | 1_2145del |
| 6 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538480.1 | 27.6% | 27.6% | 1_2166del |
| 7 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_024449018.1 | 27.6% | 27.6% | 1_2166del |
| 8 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_001368046.1 | 27.4% | 27.4% | 1_2187del |
| 9 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_017019455.1 | 27.1% | 27.1% | 1_2226del |
| 10 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538478.1 | 26.6% | 26.6% | 1_2277del |
| 11 | human | 51564 | HDAC7 | histone deacetylase 7 | XR_001748761.1 | 18.4% | 1_2550del;3379_4500del | |
| 12 | human | 51564 | HDAC7 | histone deacetylase 7 | NR_160435.1 | 17.1% | 1_2877del;3706_4827del | |
| 13 | human | 51564 | HDAC7 | histone deacetylase 7 | NR_160436.1 | 16.9% | 1_2928del;3757_4878del | |
| 14 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204281.1 | 29% | 30.8% | (many diffs) |
| 15 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204279.1 | 27.7% | 29.4% | (many diffs) |
| 16 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_011245699.1 | 27.2% | 28.9% | (many diffs) |
| 17 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204280.1 | 27.1% | 26.9% | (many diffs) |
| 18 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204278.1 | 27% | 28.6% | (many diffs) |
| 19 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_019572.3 | 26.3% | 28% | (many diffs) |
| 20 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204277.1 | 26.2% | 27.8% | (many diffs) |
| 21 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204276.1 | 26.1% | 27.7% | (many diffs) |
| 22 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204275.1 | 25.9% | 27.5% | (many diffs) |
| 23 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521205.2 | 25.9% | 27.5% | (many diffs) |
| 24 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521207.3 | 25.9% | 27.5% | (many diffs) |
| 25 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521208.3 | 25.9% | 27.5% | (many diffs) |
| 26 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521209.2 | 25.9% | 27.5% | (many diffs) |
| 27 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521210.2 | 25.9% | 27.5% | (many diffs) |
| 28 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521203.2 | 25.3% | 26.9% | (many diffs) |
| 29 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XR_875306.1 | 16.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 894
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg cttctgcttc ttcaactcag tggccatcgc ctgccggcag ctgcaacagc 121 agagcaaggc cagcaagatc ctcattgtag actgggacgt gcaccatggc aacggcaccc 181 agcaaacctt ctaccaagac cccagtgtgc tctacatctc cctgcatcgc catgacgacg 241 gcaacttctt cccggggagt ggggctgtgg atgaggtagg ggctggcagc ggtgagggct 301 tcaatgtcaa tgtggcctgg gctggaggtc tggacccccc catgggggat cctgagtacc 361 tggctgcttt caggatagtc gtgatgccca tcgcccgaga gttctctcca gacctagtcc 421 tggtgtctgc tggatttgat gctgctgagg gtcacccggc cccactgggt ggctaccatg 481 tttctgccaa atgttttgga tacatgacgc agcaactgat gaacctggca ggaggcgcag 541 tggtgctggc cttggagggt ggccatgacc tcacagccat ctgtgacgcc tctgaggcct 601 gtgtggctgc tcttctgggt aacagggtgg atcccctttc agaagaaggc tggaaacaga 661 aacccaacct caatgCCATC CGCTCTCTGG AGGCCGTGAT CCGGGTGCAC AGTAAATACT 721 GGGGCTGCAT GCAGCGCCTG GCCTCCTGTC CAGACTCCTG GGTGCCTAGA GTGCCAGGGG 781 CTGACAAAGA AGAAGTGGAG GCAGTGACCG CACTGGCGTC CCTCTCTGTG GGCATCCTGG 841 CTGAAGATAG GCCCTCGGAG CAGCTGGTGG AGGAGGAAGA ACCTATGAAT CTCTACCCAA 901 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 961 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1021 TATCTTGTGG AAAGGACGAT CCCGGCCGTT ATCTAACACA CTGACGCGTT AAGTCgacaa 1081 tcaacctctg gattacaaaa tttgtgaaag att