Transcript: Human NM_015401.5

Homo sapiens histone deacetylase 7 (HDAC7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
HDAC7 (51564)
Length:
4213
CDS:
119..3094

Additional Resources:

NCBI RefSeq record:
NM_015401.5
NBCI Gene record:
HDAC7 (51564)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015401.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255690 AGAAGCTAGCGGAGGTGATTC pLKO_005 495 CDS 100% 10.800 15.120 N HDAC7 n/a
2 TRCN0000197081 GCTAAAGAATGGTTTCGCTGT pLKO.1 2203 CDS 100% 2.160 3.024 N HDAC7 n/a
3 TRCN0000255687 GATCCGGGTGCACAGTAAATA pLKO_005 2896 CDS 100% 15.000 12.000 N HDAC7 n/a
4 TRCN0000255688 GGAGCCAAGAGGTCCCATATT pLKO_005 3558 3UTR 100% 13.200 10.560 N HDAC7 n/a
5 TRCN0000381512 CAACCTGAAGCTGCGCTATAA pLKO_005 706 CDS 100% 13.200 9.240 N HDAC7 n/a
6 TRCN0000255689 CCACTTTGCCCAGTCCTTAAT pLKO_005 1231 CDS 100% 13.200 9.240 N HDAC7 n/a
7 TRCN0000004848 GCTACCATGTTTCTGCCAAAT pLKO.1 2670 CDS 100% 10.800 7.560 N HDAC7 n/a
8 TRCN0000255686 TCACTGACCTCGCCTTCAAAG pLKO_005 2169 CDS 100% 10.800 7.560 N HDAC7 n/a
9 TRCN0000195651 CCATCTGGAATGAGCTTCATT pLKO.1 2115 CDS 100% 5.625 3.938 N HDAC7 n/a
10 TRCN0000004845 GCCAGCAAGATCCTCATTGTA pLKO.1 2327 CDS 100% 5.625 3.938 N HDAC7 n/a
11 TRCN0000197001 GCTTCTCGTGAGCTAAAGAAT pLKO.1 2192 CDS 100% 5.625 3.938 N HDAC7 n/a
12 TRCN0000195442 CAAGTAGTTGGAACCAGAGAA pLKO.1 3196 3UTR 100% 4.950 3.465 N HDAC7 n/a
13 TRCN0000199823 GCTGCGCTATAAGCCCAAGAA pLKO.1 715 CDS 100% 4.950 3.465 N HDAC7 n/a
14 TRCN0000004844 TCCACACAGAAATGTGAACTT pLKO.1 3486 3UTR 100% 4.950 3.465 N HDAC7 n/a
15 TRCN0000199374 CCACTATTCCTGGCTCTGCAA pLKO.1 3437 3UTR 100% 2.640 1.848 N HDAC7 n/a
16 TRCN0000004846 GCCCTAGAAAGAACAGTCCAT pLKO.1 533 CDS 100% 2.640 1.848 N HDAC7 n/a
17 TRCN0000039336 CCATGTTTCTGCCAAATGTTT pLKO.1 2674 CDS 100% 5.625 3.375 N Hdac7 n/a
18 TRCN0000004847 GCTGATCTATGACTCGGTCAT pLKO.1 1798 CDS 100% 4.050 2.430 N HDAC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015401.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488732 ACCAGACGAACGCTCAGACTTCCC pLX_317 10.9% 96.2% 96.2% V5 (not translated due to prior stop codon) 795_905del n/a
2 ccsbBroadEn_11998 pDONR223 100% 27.8% 27.8% None 1_2145del n/a
3 ccsbBroad304_11998 pLX_304 0% 27.8% 27.8% V5 1_2145del n/a
4 TRCN0000470023 TCCCGGCCGTTATCTAACACACTG pLX_317 27% 27.8% 27.8% V5 1_2145del n/a
Download CSV