Transcript: Mouse NM_001204275.1

Mus musculus histone deacetylase 7 (Hdac7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Hdac7 (56233)
Length:
4339
CDS:
445..3306

Additional Resources:

NCBI RefSeq record:
NM_001204275.1
NBCI Gene record:
Hdac7 (56233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001204275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039338 CTTCGGCAACTTCTCAATAAA pLKO.1 643 CDS 100% 15.000 21.000 N Hdac7 n/a
2 TRCN0000039335 TGCGCTACAAACCCAAGAAAT pLKO.1 929 CDS 100% 13.200 9.240 N Hdac7 n/a
3 TRCN0000004848 GCTACCATGTTTCTGCCAAAT pLKO.1 2885 CDS 100% 10.800 7.560 N HDAC7 n/a
4 TRCN0000039336 CCATGTTTCTGCCAAATGTTT pLKO.1 2889 CDS 100% 5.625 3.938 N Hdac7 n/a
5 TRCN0000039334 GCTGAAGTGATCCTGAAGAAA pLKO.1 715 CDS 100% 5.625 3.938 N Hdac7 n/a
6 TRCN0000039337 TGCAGATCATTCTACAGCCAT pLKO.1 2460 CDS 100% 2.640 1.848 N Hdac7 n/a
7 TRCN0000004845 GCCAGCAAGATCCTCATTGTA pLKO.1 2542 CDS 100% 5.625 3.938 N HDAC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488732 ACCAGACGAACGCTCAGACTTCCC pLX_317 10.9% 79% 82% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11998 pDONR223 100% 25.9% 27.5% None (many diffs) n/a
3 ccsbBroad304_11998 pLX_304 0% 25.9% 27.5% V5 (many diffs) n/a
4 TRCN0000470023 TCCCGGCCGTTATCTAACACACTG pLX_317 27% 25.9% 27.5% V5 (many diffs) n/a
Download CSV