Construct: ORF TRCN0000470054
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014521.1_s317c1
- Derived from:
- ccsbBroadEn_05781
- DNA Barcode:
- ACACCCCATTACCCCTCATGTACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ADORA1 (134)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470054
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 134 | ADORA1 | adenosine A1 receptor | NM_000674.3 | 99.5% | 98.7% | (many diffs) |
| 2 | human | 134 | ADORA1 | adenosine A1 receptor | NM_001048230.2 | 99.5% | 98.7% | (many diffs) |
| 3 | human | 134 | ADORA1 | adenosine A1 receptor | NM_001365065.1 | 74.7% | 58.1% | (many diffs) |
| 4 | human | 134 | ADORA1 | adenosine A1 receptor | XM_005244901.1 | 74.7% | 58.1% | (many diffs) |
| 5 | human | 134 | ADORA1 | adenosine A1 receptor | XM_005244902.4 | 74.7% | 58.1% | (many diffs) |
| 6 | human | 134 | ADORA1 | adenosine A1 receptor | NM_001365066.1 | 64.3% | 64.1% | 0_1ins348;434C>A |
| 7 | mouse | 11539 | Adora1 | adenosine A1 receptor | NM_001008533.3 | 88.2% | 93.5% | (many diffs) |
| 8 | mouse | 11539 | Adora1 | adenosine A1 receptor | NM_001039510.2 | 88.2% | 93.5% | (many diffs) |
| 9 | mouse | 11539 | Adora1 | adenosine A1 receptor | NM_001282945.1 | 88.2% | 93.5% | (many diffs) |
| 10 | mouse | 11539 | Adora1 | adenosine A1 receptor | XM_006529079.2 | 88.2% | 93.5% | (many diffs) |
| 11 | mouse | 11539 | Adora1 | adenosine A1 receptor | NM_001291928.1 | 61.1% | 60.3% | (many diffs) |
| 12 | mouse | 11539 | Adora1 | adenosine A1 receptor | NM_001291930.1 | 50.1% | 52.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gccctccatc tcagctttcc aggccgccta catcggcatc gaggtgctca 121 tcgccctggt ctctgtgccc gggaacgtgc tggtgatctg ggcggtgaag gtgaaccagg 181 cgctgcggga ttccaccttc tgcttcatcg tgccgctggc ggtggctgat gtggccgtgg 241 gtgccctggt catccccctc gccatcctca tcaacattgg gccacagacc tacttccaca 301 cctgcctcat ggttgcctgt ccggtcctca tcctcaccca gagctccatc ctggccctgc 361 tggcaattgc tgtggaccac tacctccggg tcaagatccc tctccggtac aagatggtgg 421 tgaccccccg gagggcggcg gtggccatag ccggctgctg gatcctctcc ttcgtggtgg 481 gactgacccc tatgtttggc tggaacaatc tgagtgcggt ggagcgggcc tgggcagcca 541 acggcagcat gggggagccc gtgatcaagt gcgagttcga gaaggtcatc agcatggagt 601 acatggtcta cttcaacttc tttgtgtggg tgctgccccc gcttctcctc atggtcctca 661 tctacctgga ggtcttctac ctaatccgca agcagctcaa caagaaggtg tcggcctccT 721 CCGGCGACCC GCAGAAGTAC TATGGGAAGG AGCTGAAGAT CGCCAAGTCG CTGGCCCTCA 781 TCCTCTTCCT CTTTGCCCTC AGCTGGCTGC CTTTGCACAT CCTCAACTGC ATCACCCTCT 841 TCTGCCAGTC CTGCCACAAG CCCAGCATCC TTACCTACAT TGCCATCTTC CTCACGCACG 901 GCAACTCGGC CATGAACCCC ATTGTCTATG CCTTCCGCAT CCAGAAGTTC CGCGTCACCT 961 TCCTTAAGAT TTGGAATGAC CATTTCCGCT GCCAGCCTGC ACCTCCCATT GACGAGGATC 1021 TCCCAGAAGA GAGGCCTGAT GACTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CACCCCATTA 1201 CCCCTCATGT ACGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att