Transcript: Human XM_005244902.4

PREDICTED: Homo sapiens adenosine A1 receptor (ADORA1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADORA1 (134)
Length:
2694
CDS:
413..1189

Additional Resources:

NCBI RefSeq record:
XM_005244902.4
NBCI Gene record:
ADORA1 (134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005244902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356601 GCGTCACCTTCCTTAAGATTT pLKO_005 1095 CDS 100% 13.200 10.560 N ADORA1 n/a
2 TRCN0000356602 CCAGCATCCTTACCTACATTG pLKO_005 1005 CDS 100% 10.800 7.560 N ADORA1 n/a
3 TRCN0000356599 GTCCCTCCACTAGGAGTTAAC pLKO_005 1342 3UTR 100% 10.800 7.560 N ADORA1 n/a
4 TRCN0000008037 CCCAGCATCCTTACCTACATT pLKO.1 1004 CDS 100% 5.625 3.938 N ADORA1 n/a
5 TRCN0000008040 CGCGTCACCTTCCTTAAGATT pLKO.1 1094 CDS 100% 5.625 3.938 N ADORA1 n/a
6 TRCN0000008039 CATGGAGTACATGGTCTACTT pLKO.1 736 CDS 100% 4.950 3.465 N ADORA1 n/a
7 TRCN0000008038 CCTTACCTACATTGCCATCTT pLKO.1 1012 CDS 100% 4.950 3.465 N ADORA1 n/a
8 TRCN0000008036 CCCTAGTATCTGGCTGGGTTT pLKO.1 2308 3UTR 100% 4.050 2.835 N ADORA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005244902.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491338 ACGTTATTCAATCGTGCCACTTTC pLX_317 33.5% 74.7% 60.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488625 ACGGCTATTTTTTCAATAGTGAGA pLX_317 32.3% 74.7% 60.7% V5 (many diffs) n/a
3 ccsbBroadEn_05781 pDONR223 100% 74.7% 58.1% None (many diffs) n/a
4 ccsbBroad304_05781 pLX_304 0% 74.7% 58.1% V5 (many diffs) n/a
5 TRCN0000470054 ACACCCCATTACCCCTCATGTACG pLX_317 33.5% 74.7% 58.1% V5 (many diffs) n/a
Download CSV