Construct: ORF TRCN0000470063
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007990.1_s317c1
- Derived from:
- ccsbBroadEn_10947
- DNA Barcode:
- GTCACAGTACGACTGTGGATATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ABLIM1 (3983)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470063
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322896.2 | 100% | 100% | |
| 2 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322892.2 | 93.9% | 93.9% | 94_171del |
| 3 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322893.2 | 93.9% | 93.9% | 94_171del |
| 4 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322890.2 | 93.4% | 93.4% | 94_171del;541_546delGATGCA |
| 5 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322891.2 | 93.4% | 93.4% | 94_171del;541_546delGATGCA |
| 6 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322897.2 | 89.4% | 81.1% | (many diffs) |
| 7 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322900.2 | 88.2% | 88.2% | 462_463ins141 |
| 8 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_006720.4 | 88.1% | 88.1% | 94_255del |
| 9 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448022.1 | 86.7% | 86.7% | 94_171del;493_597del |
| 10 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001352443.2 | 86.4% | 86.4% | 94_171del;493_597del;646_651delGATGCA |
| 11 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016259.1 | 86.4% | 86.4% | 94_171del;493_597del;646_651delGATGCA |
| 12 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322894.2 | 84.1% | 76.6% | (many diffs) |
| 13 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322895.2 | 84.1% | 76.6% | (many diffs) |
| 14 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322898.2 | 82.9% | 82.9% | 94_171del;540_541ins141 |
| 15 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322899.2 | 82.9% | 82.9% | 94_171del;540_541ins141 |
| 16 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322888.2 | 79.9% | 70.5% | (many diffs) |
| 17 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_005269827.4 | 79.5% | 79.5% | 94_171del;493_717del;766_771delGATGCA |
| 18 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_006717847.1 | 79.5% | 79.5% | 94_171del;493_717del;766_771delGATGCA |
| 19 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322889.2 | 79% | 72.2% | (many diffs) |
| 20 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_005269826.1 | 75.3% | 75.3% | 94_255del;577_801del;850_855delGATGCA |
| 21 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_006717846.3 | 75.3% | 75.3% | 94_255del;577_801del;850_855delGATGCA |
| 22 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001352442.2 | 67.8% | 67.8% | 1_492del;586_663del |
| 23 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016247.1 | 64.7% | 64.7% | 1_492del;586_747del |
| 24 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448011.1 | 61.3% | 61.3% | 1_492del;586_747del;1069_1173del |
| 25 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448020.1 | 61.2% | 56.5% | (many diffs) |
| 26 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322885.3 | 60.2% | 60.2% | 1_717del;811_888del |
| 27 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322884.3 | 60% | 60% | 1_717del;811_888del;1258_1263delGATGCA |
| 28 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448013.1 | 60% | 60% | (many diffs) |
| 29 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016256.1 | 59.9% | 59.9% | 1_720del;814_891del;1261_1266delGATGCA |
| 30 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448021.1 | 59.8% | 59.8% | 1_492del;586_663del;1032_1033ins141 |
| 31 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016248.1 | 59.2% | 53.1% | (many diffs) |
| 32 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322883.2 | 58.7% | 58.7% | 1_768del;862_939del |
| 33 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448015.1 | 58.4% | 54.1% | (many diffs) |
| 34 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448010.1 | 57.7% | 57.7% | 1_492del;586_747del;1069_1293del |
| 35 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_011539801.2 | 57.6% | 57.6% | (many diffs) |
| 36 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_011539805.1 | 57.6% | 57.6% | (many diffs) |
| 37 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448018.1 | 57.5% | 57.5% | 1_720del;814_975del;1345_1350delGATGCA |
| 38 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448017.1 | 57.1% | 57.1% | 1_492del;586_747del;1116_1117ins141 |
| 39 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016255.1 | 57% | 57% | (many diffs) |
| 40 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448012.1 | 56.7% | 51% | (many diffs) |
| 41 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001003407.2 | 55.8% | 55.8% | 1_768del;862_939del;1261_1365del |
| 42 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322886.3 | 54.4% | 50.4% | (many diffs) |
| 43 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001352440.1 | 54.3% | 50.4% | (many diffs) |
| 44 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016250.1 | 53.9% | 53.9% | (many diffs) |
| 45 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448016.1 | 53.8% | 53.8% | (many diffs) |
| 46 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322882.2 | 53.6% | 53.6% | (many diffs) |
| 47 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001352441.1 | 53% | 53% | 1_720del;814_891del;1260_1261ins141 |
| 48 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_017016245.1 | 52% | 52% | (many diffs) |
| 49 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448014.1 | 51.9% | 51.9% | (many diffs) |
| 50 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_001322887.2 | 51.8% | 51.8% | 1_768del;862_939del;1308_1309ins141 |
| 51 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | NM_002313.7 | 51.5% | 51.5% | 1_948del;1042_1119del;1441_1545del |
| 52 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_011539802.2 | 51.5% | 51.5% | (many diffs) |
| 53 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_006717837.2 | 50.8% | 50.8% | (many diffs) |
| 54 | human | 3983 | ABLIM1 | actin binding LIM protein 1 | XM_024448019.1 | 31.9% | 22.1% | (many diffs) |
| 55 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_001347459.1 | 84.2% | 88.7% | (many diffs) |
| 56 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318184.1 | 83.8% | 88.3% | (many diffs) |
| 57 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318186.1 | 74% | 78.9% | (many diffs) |
| 58 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527048.3 | 71.3% | 75.1% | (many diffs) |
| 59 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318182.1 | 67.6% | 71.2% | (many diffs) |
| 60 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318183.1 | 67.6% | 71.2% | (many diffs) |
| 61 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_001103178.2 | 65.8% | 69.4% | (many diffs) |
| 62 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_001290816.1 | 53.7% | 56.6% | (many diffs) |
| 63 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318178.1 | 52.8% | 55.7% | (many diffs) |
| 64 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527041.3 | 52.7% | 55.5% | (many diffs) |
| 65 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_001103177.2 | 51.2% | 53.9% | (many diffs) |
| 66 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527039.3 | 50.8% | 53.5% | (many diffs) |
| 67 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527038.3 | 50.6% | 53.3% | (many diffs) |
| 68 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527037.3 | 50.3% | 53% | (many diffs) |
| 69 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318180.1 | 48.9% | 48% | (many diffs) |
| 70 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_001290815.1 | 48.8% | 48% | (many diffs) |
| 71 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527035.3 | 48.4% | 51% | (many diffs) |
| 72 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527034.3 | 48.2% | 50.8% | (many diffs) |
| 73 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318179.1 | 47.9% | 47.1% | (many diffs) |
| 74 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527033.3 | 47.5% | 50% | (many diffs) |
| 75 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318177.1 | 47.1% | 44.6% | (many diffs) |
| 76 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318176.1 | 46.8% | 49.4% | (many diffs) |
| 77 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318175.1 | 46.6% | 49.1% | (many diffs) |
| 78 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318174.1 | 46.5% | 49% | (many diffs) |
| 79 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318181.1 | 46.4% | 49.5% | (many diffs) |
| 80 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318173.1 | 46.3% | 48.8% | (many diffs) |
| 81 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527040.3 | 46% | 45.3% | (many diffs) |
| 82 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_017318172.1 | 45.9% | 48.4% | (many diffs) |
| 83 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527028.3 | 45.8% | 48.2% | (many diffs) |
| 84 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527036.3 | 45.3% | 43% | (many diffs) |
| 85 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | XM_006527044.3 | 44.6% | 47.5% | (many diffs) |
| 86 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_001290813.1 | 43.9% | 43.3% | (many diffs) |
| 87 | mouse | 226251 | Ablim1 | actin-binding LIM protein 1 | NM_178688.3 | 41.7% | 43.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1269
- ORF length:
- 1203
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt cacagaagga gaggaaatgt atcttcaagg ctccaccgtt tggcatcccg 121 actgtaagca atctacgaag accgaggaaa agctgcgggc aaaagtagac aatgagatcc 181 tggattacaa ggatttagca gccattccga aggtcaaggc aatttatgac attgaacgtc 241 cagatcttat tacctatgag cctttctaca cttcgggcta tgatgacaaa caggagagac 301 agagccttgg agagtctccg aggactttgt ctcctactcc atcagcagaa gggtaccagg 361 atgttcggga tcggatgatc catcggtcca cgagccaggg ctccatcaac tcccctgtgt 421 acagccgcca cagctacact ccaaccacgt cccgctctcc ccagcatttc cacagacctg 481 atcaaggaat caacatttac cgaaagccac ccatctacaa acagcatgct gccttggcag 541 cccagagcaa gtcctcagaa gatatcatca agttttccaa gttcccagca gcccaggcac 601 cagaccccag cgagacacca aagattgaga cggaccactg gcctggtccc ccctcatttg 661 ctgtcgtagg acctgacatg aaacgcagat ctagtggcag agaggaagat gatgaggaac 721 ttctgagacg tcggcagctt caagaagagc aattaatgaa gcttaactca ggcctgggac 781 agttgatctt gaaagaagag atggagaaag agagccggga aaggtcatct ctgttagcca 841 gtcgctacga ttctcccatc aactcagctt cacatattcc atcatctaaa actgcatctc 901 tccctggcta tGGAAGAAAT GGGCTTCACC GGCCTGTTTC TACCGACTTC GCTCAGTATA 961 ACAGCTATGG GGATGTCAGC GGGGGAGTGC GAGATTACCA GACACTCCCA GATGGCCACA 1021 TGCCTGCAAT GAGAATGGAC CGAGGAGTGT CTATGCCCAA CATGTTGGAA CCAAAGATAT 1081 TTCCATATGA AATGCTCATG GTGACCAACA GAGGGCGAAA CAAAATCCTC AGAGAGGTGG 1141 ACAGAACCAG GCTGGAGCGC CACTTAGCCC CTGAAGTGTT TCGGGAAATC TTTGGAATGT 1201 CCATACAGGA GTTTGACAGG TTACCTCTTT GGAGACGCAA CGACATGAAG AAAAAAGCAA 1261 AACTCTTCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1321 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1381 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGTCACA GTACGACTGT GGATATTGAC 1441 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt