Transcript: Human XM_011539805.1

PREDICTED: Homo sapiens actin binding LIM protein 1 (ABLIM1), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABLIM1 (3983)
Length:
7822
CDS:
584..2674

Additional Resources:

NCBI RefSeq record:
XM_011539805.1
NBCI Gene record:
ABLIM1 (3983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416304 CCGAAGGTCAAGGCAATTTAT pLKO_005 1379 CDS 100% 15.000 21.000 N ABLIM1 n/a
2 TRCN0000061899 CCTCGGAAAGTATTTATTCTA pLKO.1 1266 CDS 100% 5.625 7.875 N ABLIM1 n/a
3 TRCN0000433673 TTGAACGTCCAGATCTTATTA pLKO_005 1404 CDS 100% 15.000 12.000 N ABLIM1 n/a
4 TRCN0000061901 CCTGTCATTCACTGCCATAAA pLKO.1 410 5UTR 100% 13.200 9.240 N ABLIM1 n/a
5 TRCN0000429921 TCGGGTCCAGACCAAACATTT pLKO_005 460 5UTR 100% 13.200 9.240 N ABLIM1 n/a
6 TRCN0000061900 CCCTGAAGTGTTTCGGGAAAT pLKO.1 2572 CDS 100% 10.800 7.560 N ABLIM1 n/a
7 TRCN0000435408 GGCTCACCAGGTCATACTATC pLKO_005 1307 CDS 100% 10.800 7.560 N ABLIM1 n/a
8 TRCN0000061898 GCCACTTTATTATCATGCTTT pLKO.1 4252 3UTR 100% 4.950 3.465 N ABLIM1 n/a
9 TRCN0000061902 GCCCAACATGTTGGAACCAAA pLKO.1 2458 CDS 100% 4.950 3.465 N ABLIM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10947 pDONR223 100% 57.6% 57.6% None (many diffs) n/a
2 ccsbBroad304_10947 pLX_304 0% 57.6% 57.6% V5 (many diffs) n/a
3 TRCN0000470063 GTCACAGTACGACTGTGGATATTG pLX_317 30% 57.6% 57.6% V5 (many diffs) n/a
Download CSV