Transcript: Mouse XM_006527033.3

PREDICTED: Mus musculus actin-binding LIM protein 1 (Ablim1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ablim1 (226251)
Length:
6549
CDS:
327..2597

Additional Resources:

NCBI RefSeq record:
XM_006527033.3
NBCI Gene record:
Ablim1 (226251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099290 CCTCCTCTGAAAGTATCTATT pLKO.1 1189 CDS 100% 13.200 10.560 N Ablim1 n/a
2 TRCN0000317867 CCTCCTCTGAAAGTATCTATT pLKO_005 1189 CDS 100% 13.200 10.560 N Ablim1 n/a
3 TRCN0000061901 CCTGTCATTCACTGCCATAAA pLKO.1 420 CDS 100% 13.200 9.240 N ABLIM1 n/a
4 TRCN0000099293 CCCAACGAGATACCAAAGATT pLKO.1 1935 CDS 100% 5.625 3.938 N Ablim1 n/a
5 TRCN0000317870 CCCAACGAGATACCAAAGATT pLKO_005 1935 CDS 100% 5.625 3.938 N Ablim1 n/a
6 TRCN0000099294 AGGCCATACTATCTATGCAAA pLKO.1 1241 CDS 100% 4.950 3.465 N Ablim1 n/a
7 TRCN0000317868 AGGCCATACTATCTATGCAAA pLKO_005 1241 CDS 100% 4.950 3.465 N Ablim1 n/a
8 TRCN0000061902 GCCCAACATGTTGGAACCAAA pLKO.1 2381 CDS 100% 4.950 3.465 N ABLIM1 n/a
9 TRCN0000099292 GCTTCAAGAAGAACAGTTGAT pLKO.1 2066 CDS 100% 4.950 3.465 N Ablim1 n/a
10 TRCN0000099291 GCCTTTCTACACATCAGGCTA pLKO.1 1358 CDS 100% 2.640 1.848 N Ablim1 n/a
11 TRCN0000317869 GCCTTTCTACACATCAGGCTA pLKO_005 1358 CDS 100% 2.640 1.848 N Ablim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10947 pDONR223 100% 47.5% 50% None (many diffs) n/a
2 ccsbBroad304_10947 pLX_304 0% 47.5% 50% V5 (many diffs) n/a
3 TRCN0000470063 GTCACAGTACGACTGTGGATATTG pLX_317 30% 47.5% 50% V5 (many diffs) n/a
Download CSV