Construct: ORF TRCN0000470131
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015728.1_s317c1
- Derived from:
- ccsbBroadEn_11026
- DNA Barcode:
- AGTACCCTGTGTGGATGCTTGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PER1 (5187)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470131
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5187 | PER1 | period circadian regulator 1 | XM_024450803.1 | 35.7% | 34.9% | (many diffs) |
| 2 | human | 5187 | PER1 | period circadian regulator 1 | XM_005256690.1 | 23.7% | 23.1% | (many diffs) |
| 3 | human | 5187 | PER1 | period circadian regulator 1 | NM_002616.3 | 22.6% | 22% | (many diffs) |
| 4 | human | 5187 | PER1 | period circadian regulator 1 | XM_005256689.2 | 22.6% | 22% | (many diffs) |
| 5 | mouse | 18626 | Per1 | period circadian clock 1 | XM_006532481.3 | 20.3% | 21.5% | (many diffs) |
| 6 | mouse | 18626 | Per1 | period circadian clock 1 | NM_001159367.1 | 20.3% | 21.4% | (many diffs) |
| 7 | mouse | 18626 | Per1 | period circadian clock 1 | NM_011065.4 | 20.3% | 21.4% | (many diffs) |
| 8 | mouse | 18626 | Per1 | period circadian clock 1 | XM_006532480.3 | 20.3% | 21.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tggcccccta gaaggggctg atgggggagg ggaccccagg cctggggaat 121 cattttgtcc tgggggcgtc ccatcccctg ggcccccaca gcaccggcct tgcccaggcc 181 ccagcctggc cgatgacacc gatgccaaca gcaatggttc aagtggcaat gagtccaacg 241 ggcatgagtc tagaggcgca tctcagcgga gctcacacag ctcctcctca ggcaacggca 301 aggactcagc cctgctggag accactgaga gcagcaagag cacaaactct cagagcccat 361 ccccacccag cagttccatt gcctacagcc tcctgagtgc cagctcagag caggacaacc 421 cgtccaccag tggctgcagc agtgaacagt cagcccgggc aaggactcag aaggaactca 481 tgacagcact tcgagagctc aagcttcgac tgccgccaga gcgccggggc aagggccgcT 541 CTGGGACCCT GGCCACGCTG CAGTACGCAC TGGCCTGTGT CAAGCAGGTG CAGGCCAACC 601 AGGAATACTA CCAGCAGTGG AGCCTGGAGG AGGGCGAGCC TTGCTCCATG GACATGTCCA 661 CCTATACCCT GGAGGAGCTG GAGCACATCA CGTCTGAGTA CACACTTCAG AACCAGGATA 721 CCTTCTCAGT GGCTGTCTCC TTCCTGACGG GCCGAATCGT CTACATTTCG GAGCAGGCAG 781 CCGTCCTGCT GCGTTGCAAG CGGGACGTGT TCCGGGGTAC CCGCTTCTCT GAGCTCCTGG 841 CTCCCCAGGA TGTGGGAGTC TTCTATGGTT CCACTGCTCC ATCTCGCCTG CCCACCTGGG 901 GCACAGGGGC CTCAGCAGGT GAGGTGCCCA AGCGCTGTGG GGAGGCATGC CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGAAGTACCC TGTGTGGATG CTTGCCCACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt