Transcript: Mouse XM_006532480.3

PREDICTED: Mus musculus period circadian clock 1 (Per1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Per1 (18626)
Length:
4781
CDS:
300..4175

Additional Resources:

NCBI RefSeq record:
XM_006532480.3
NBCI Gene record:
Per1 (18626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006532480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238337 TTCGTGTTGGGTCGCCATAAA pLKO_005 1659 CDS 100% 13.200 18.480 N Per1 n/a
2 TRCN0000075403 GCTGAAGTGGTCTGTCCAAAT pLKO.1 4449 3UTR 100% 10.800 15.120 N Per1 n/a
3 TRCN0000075404 GCCGATCTAAAGCAAAGCGTT pLKO.1 2794 CDS 100% 2.640 3.696 N Per1 n/a
4 TRCN0000238339 GGTGCTCCCTAACTATCTATT pLKO_005 3059 CDS 100% 13.200 10.560 N Per1 n/a
5 TRCN0000238338 GACAGCATCCTCAGGTATTTG pLKO_005 2193 CDS 100% 13.200 9.240 N Per1 n/a
6 TRCN0000075405 CCCAGTACAACCAAGCGTAAA pLKO.1 2229 CDS 100% 10.800 7.560 N Per1 n/a
7 TRCN0000244220 CCTTGGTGCTCCCTAACTATC pLKO_005 3055 CDS 100% 10.800 7.560 N PER1 n/a
8 TRCN0000238335 GGAGCATATCACATCCGAATA pLKO_005 914 CDS 100% 10.800 7.560 N Per1 n/a
9 TRCN0000238336 GGTTCTTATAACTCAAGATAC pLKO_005 4235 3UTR 100% 10.800 7.560 N Per1 n/a
10 TRCN0000075407 CCAGCGTGTCATGATGACATA pLKO.1 3710 CDS 100% 4.950 3.465 N Per1 n/a
11 TRCN0000075406 TCCCAGTACAACCAAGCGTAA pLKO.1 2228 CDS 100% 4.050 2.835 N Per1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006532480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11025 pDONR223 100% 39.4% 41.5% None (many diffs) n/a
2 ccsbBroad304_11025 pLX_304 .4% 39.4% 41.5% V5 (many diffs) n/a
3 ccsbBroadEn_11026 pDONR223 100% 20.3% 21.4% None (many diffs) n/a
4 ccsbBroad304_11026 pLX_304 0% 20.3% 21.4% V5 (many diffs) n/a
5 TRCN0000470131 AGTACCCTGTGTGGATGCTTGCCC pLX_317 46.4% 20.3% 21.4% V5 (many diffs) n/a
Download CSV