Transcript: Human XM_024450803.1

PREDICTED: Homo sapiens period circadian regulator 1 (PER1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PER1 (5187)
Length:
3170
CDS:
194..2641

Additional Resources:

NCBI RefSeq record:
XM_024450803.1
NBCI Gene record:
PER1 (5187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074184 CCAGCACCACTAAGCGTAAAT pLKO.1 2124 CDS 100% 13.200 18.480 N PER1 n/a
2 TRCN0000236033 CAGCACCACTAAGCGTAAATG pLKO_005 2125 CDS 100% 13.200 9.240 N PER1 n/a
3 TRCN0000236034 CATGGACATGTCCACCTATAC pLKO_005 775 CDS 100% 10.800 7.560 N PER1 n/a
4 TRCN0000074186 CCATGGACATGTCCACCTATA pLKO.1 774 CDS 100% 10.800 7.560 N PER1 n/a
5 TRCN0000074187 GCACAAACTCTCAGAGCCCAT pLKO.1 468 CDS 100% 2.160 1.512 N PER1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11025 pDONR223 100% 70.1% 67.6% None 1630_1735del;1823_2445del n/a
2 ccsbBroad304_11025 pLX_304 .4% 70.1% 67.6% V5 1630_1735del;1823_2445del n/a
3 ccsbBroadEn_11026 pDONR223 100% 35.7% 34.9% None (many diffs) n/a
4 ccsbBroad304_11026 pLX_304 0% 35.7% 34.9% V5 (many diffs) n/a
5 TRCN0000470131 AGTACCCTGTGTGGATGCTTGCCC pLX_317 46.4% 35.7% 34.9% V5 (many diffs) n/a
Download CSV