Construct: ORF TRCN0000470179
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011144.1_s317c1
- Derived from:
- ccsbBroadEn_08512
- DNA Barcode:
- AACCAATAGTCGGACCCGTTAGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CPPED1 (55313)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470179
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55313 | CPPED1 | calcineurin like phosphoest... | NM_018340.3 | 99.7% | 99.3% | 56C>A;722A>G |
| 2 | human | 55313 | CPPED1 | calcineurin like phosphoest... | NM_001099455.2 | 54.5% | 54.1% | 56C>A;286_287ins426;296A>G |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1008
- ORF length:
- 942
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggctgcagag gcggggggtg ttttccacag agccaggggc aggaccctgg 121 acgcgtttcc cgcagaaaag gaaagcgaat ggaaaggccc attctacttc atcctgggcg 181 cagacccaca gtttgggctg atcaaggcct ggtccactgg ggactgtgac aatggcggtg 241 acgaatggga acaggagatc cgtctaactg agcaagccgt ccaggccatc aacaagctga 301 accccaaacc caaattcttc gttctgtgcg gcgacctcat ccacgccatg ccagggaagc 361 cgtggcggac ggagcagacg gaggacctga agcgagtgct tagggcagtg gacagggcca 421 tcccactggt ccttgtcagc ggcaaccatg acattggcaa cacccccacg gccgagaccg 481 tcgaggagtt ctgccggact tggggagatg actacttcag cttctgggtc gggggcgtcc 541 tgttcctggt cctcaactcc cagttctacg agaacccctc caaatgcccc agcctgaagc 601 aggcTCAGGA CCAGTGGCTG GACGAGCAGC TGAGCATCGC GAGGCAGCGG CACTGCCAGC 661 ATGCCATCGT CTTCCAGCAC ATCCCGCTGT TCCTGGAGAG CATCGACGAG GACGACGACT 721 ACTACTTCAA CCTCAGCAAG TCCACTCGGA AGAAGTTGGC AGACAAGTTC ATCCACGCAG 781 GTGTCAGAGT CGTGTTCTCA GGCCACTACC ACAGGAATGC CGGGGGTACC TACCAGAACC 841 TCGACATGGT GGTGTCATCT GCCATTGGAT GCCAGCTGGG CAGAGACCCC CACGGGCTCC 901 GAGTCGTGGT GGTCACCGCC GAGAAAATTG TTCACCGATA CTACAGTCTA GATGAGCTGA 961 GTGAGAAAGG AATAGAAGAC GATCTCATGG ATTTGATCAA GAAAAAATGC CCAACTTTCT 1021 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1081 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1141 GTGGAAAGGA CGAAACCAAT AGTCGGACCC GTTAGGCACG CGTTAAGTCg acaatcaacc 1201 tctggattac aaaatttgtg aaagatt