Transcript: Human NM_001099455.2

Homo sapiens calcineurin like phosphoesterase domain containing 1 (CPPED1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CPPED1 (55313)
Length:
5717
CDS:
112..630

Additional Resources:

NCBI RefSeq record:
NM_001099455.2
NBCI Gene record:
CPPED1 (55313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001099455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419236 GGGCCCTGTCCTGAATTATAT pLKO_005 778 3UTR 100% 15.000 21.000 N CPPED1 n/a
2 TRCN0000437217 GGAACAGGAGATCCGTCTAAC pLKO_005 294 CDS 100% 10.800 15.120 N CPPED1 n/a
3 TRCN0000051933 GTTCACCGATACTACAGTCTA pLKO.1 550 CDS 100% 4.950 6.930 N CPPED1 n/a
4 TRCN0000417126 ATTGTATTCTGGTTAGCATAT pLKO_005 936 3UTR 100% 10.800 7.560 N CPPED1 n/a
5 TRCN0000051936 CTCATGGATTTGATCAAGAAA pLKO.1 604 CDS 100% 5.625 3.938 N CPPED1 n/a
6 TRCN0000420250 CAAACCCAAATTCTTCGTTCT pLKO_005 351 CDS 100% 4.050 2.835 N CPPED1 n/a
7 TRCN0000051934 CGAATGGAAAGGCCCATTCTA pLKO.1 192 CDS 100% 0.563 0.394 N CPPED1 n/a
8 TRCN0000416850 ACTACACCTGATTGTATTAAA pLKO_005 1029 3UTR 100% 15.000 9.000 N CPPED1 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2175 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 4640 3UTR 100% 1.080 0.540 Y GPR83 n/a
11 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 4640 3UTR 100% 1.080 0.540 Y MYORG n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2176 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4983 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08512 pDONR223 100% 54.5% 54.1% None 56C>A;286_287ins426;296A>G n/a
2 ccsbBroad304_08512 pLX_304 0% 54.5% 54.1% V5 56C>A;286_287ins426;296A>G n/a
3 TRCN0000470179 AACCAATAGTCGGACCCGTTAGGC pLX_317 43% 54.5% 54.1% V5 56C>A;286_287ins426;296A>G n/a
Download CSV