Transcript: Human NM_018340.3

Homo sapiens calcineurin like phosphoesterase domain containing 1 (CPPED1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CPPED1 (55313)
Length:
6143
CDS:
112..1056

Additional Resources:

NCBI RefSeq record:
NM_018340.3
NBCI Gene record:
CPPED1 (55313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419236 GGGCCCTGTCCTGAATTATAT pLKO_005 1204 3UTR 100% 15.000 21.000 N CPPED1 n/a
2 TRCN0000437217 GGAACAGGAGATCCGTCTAAC pLKO_005 294 CDS 100% 10.800 15.120 N CPPED1 n/a
3 TRCN0000051933 GTTCACCGATACTACAGTCTA pLKO.1 976 CDS 100% 4.950 6.930 N CPPED1 n/a
4 TRCN0000417126 ATTGTATTCTGGTTAGCATAT pLKO_005 1362 3UTR 100% 10.800 7.560 N CPPED1 n/a
5 TRCN0000051936 CTCATGGATTTGATCAAGAAA pLKO.1 1030 CDS 100% 5.625 3.938 N CPPED1 n/a
6 TRCN0000420250 CAAACCCAAATTCTTCGTTCT pLKO_005 351 CDS 100% 4.050 2.835 N CPPED1 n/a
7 TRCN0000051937 CAACTCCCAGTTCTACGAGAA pLKO.1 600 CDS 100% 4.050 2.835 N CPPED1 n/a
8 TRCN0000051934 CGAATGGAAAGGCCCATTCTA pLKO.1 192 CDS 100% 0.563 0.394 N CPPED1 n/a
9 TRCN0000416850 ACTACACCTGATTGTATTAAA pLKO_005 1455 3UTR 100% 15.000 9.000 N CPPED1 n/a
10 TRCN0000417265 AGTTGGCAGACAAGTTCATCC pLKO_005 800 CDS 100% 4.050 2.430 N CPPED1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2601 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 5066 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 5066 3UTR 100% 1.080 0.540 Y MYORG n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2602 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5409 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08512 pDONR223 100% 99.7% 99.3% None 56C>A;722A>G n/a
2 ccsbBroad304_08512 pLX_304 0% 99.7% 99.3% V5 56C>A;722A>G n/a
3 TRCN0000470179 AACCAATAGTCGGACCCGTTAGGC pLX_317 43% 99.7% 99.3% V5 56C>A;722A>G n/a
Download CSV