Construct: ORF TRCN0000470181
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011420.1_s317c1
- Derived from:
- ccsbBroadEn_00237
- DNA Barcode:
- TACTTTTGGCGGTGATTAGGTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCND3 (896)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470181
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 896 | CCND3 | cyclin D3 | NM_001760.4 | 100% | 100% | |
2 | human | 896 | CCND3 | cyclin D3 | NM_001287427.1 | 81.5% | 76.8% | (many diffs) |
3 | human | 896 | CCND3 | cyclin D3 | XM_011514971.2 | 76.5% | 65.6% | 573_574ins137;740_828del |
4 | human | 896 | CCND3 | cyclin D3 | NM_001136125.2 | 75.3% | 75.3% | 197_198ins216 |
5 | human | 896 | CCND3 | cyclin D3 | NM_001136017.3 | 72.2% | 72.2% | 0_1ins243 |
6 | human | 896 | CCND3 | cyclin D3 | XM_011514972.1 | 51.3% | 40% | 0_1ins243;330_331ins137;497_585del |
7 | human | 896 | CCND3 | cyclin D3 | NM_001136126.2 | 32.8% | 32.8% | 0_1ins588 |
8 | human | 896 | CCND3 | cyclin D3 | NM_001287434.1 | 32.8% | 32.8% | 0_1ins588 |
9 | mouse | 12445 | Ccnd3 | cyclin D3 | NM_001081635.1 | 90.5% | 94.5% | (many diffs) |
10 | mouse | 12445 | Ccnd3 | cyclin D3 | NM_001081636.1 | 90.5% | 94.5% | (many diffs) |
11 | mouse | 12445 | Ccnd3 | cyclin D3 | NM_007632.2 | 90.5% | 94.5% | (many diffs) |
12 | mouse | 12445 | Ccnd3 | cyclin D3 | XM_011246262.1 | 71.8% | 73% | (many diffs) |
13 | mouse | 12445 | Ccnd3 | cyclin D3 | XM_006523552.1 | 69.9% | 72.2% | (many diffs) |
14 | mouse | 12445 | Ccnd3 | cyclin D3 | XM_006523553.3 | 29.6% | 30.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gctgctgtgt tgcgaaggca cccggcacgc gccccgggcc gggccggacc 121 cgcggctgct gggggaccag cgtgtcctgc agagcctgct ccgcctggag gagcgctacg 181 taccccgcgc ctcctacttc cagtgcgtgc agcgggagat caagccgcac atgcggaaga 241 tgctggctta ctggatgctg gaggtatgtg aggagcagcg ctgtgaggag gaagtcttcc 301 ccctggccat gaactacctg gatcgctacc tgtcttgcgt ccccacccga aaggcgcagt 361 tgcagctcct gggtgcggtc tgcatgctgc tggcctccaa gctgcgcgag accacgcccc 421 tgaccatcga aaaactgtgc atctacaccg accacgctgt ctctccccgc cagttgcggg 481 actgggaggt gctggtccta gggaagctca agtgggacct ggctgctgtg attgcacatg 541 atttcctggc cTTCATTCTG CACCGGCTCT CTCTGCCCCG TGACCGACAG GCCTTGGTCA 601 AAAAGCATGC CCAGACCTTT TTGGCCCTCT GTGCTACAGA TTATACCTTT GCCATGTACC 661 CGCCATCCAT GATCGCCACG GGCAGCATTG GGGCTGCAGT GCAAGGCCTG GGTGCCTGCT 721 CCATGTCCGG GGATGAGCTC ACAGAGCTGC TGGCAGGGAT CACTGGCACT GAAGTGGACT 781 GCCTGCGGGC CTGTCAGGAG CAGATCGAAG CTGCACTCAG GGAGAGCCTC AGGGAAGCCT 841 CTCAGACCAG CTCCAGCCCA GCGCCCAAAG CCCCCCGGGG CTCCAGCAGC CAAGGGCCCA 901 GCCAGACCAG CACTCCTACA GATGTCACAG CCATACACCT GTACCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGATAC TTTTGGCGGT GATTAGGTCT GACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t