Transcript: Human NM_001287434.1

Homo sapiens cyclin D3 (CCND3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
CCND3 (896)
Length:
2065
CDS:
751..1041

Additional Resources:

NCBI RefSeq record:
NM_001287434.1
NBCI Gene record:
CCND3 (896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003830 CTAGGGTTATTGCATTTGGAT pLKO.1 1431 3UTR 100% 3.000 4.200 N CCND3 n/a
2 TRCN0000338380 CTAGGGTTATTGCATTTGGAT pLKO_005 1431 3UTR 100% 3.000 4.200 N CCND3 n/a
3 TRCN0000003826 CAGACCAGCACTCCTACAGAT pLKO.1 1000 CDS 100% 4.950 3.465 N CCND3 n/a
4 TRCN0000003829 CCAGCACTCCTACAGATGTCA pLKO.1 1004 CDS 100% 3.000 2.100 N CCND3 n/a
5 TRCN0000338379 CCAGCACTCCTACAGATGTCA pLKO_005 1004 CDS 100% 3.000 2.100 N CCND3 n/a
6 TRCN0000003828 GCACATGATTTCCTGGCCTTC pLKO.1 631 5UTR 100% 2.250 1.575 N CCND3 n/a
7 TRCN0000338378 GCACATGATTTCCTGGCCTTC pLKO_005 631 5UTR 100% 2.250 1.575 N CCND3 n/a
8 TRCN0000054895 ACTGAAGTGGACTGCCTGCGA pLKO.1 865 CDS 100% 0.220 0.154 N Ccnd3 n/a
9 TRCN0000287251 ACTGAAGTGGACTGCCTGCGA pLKO_005 865 CDS 100% 0.220 0.154 N Ccnd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00237 pDONR223 100% 32.8% 32.8% None 0_1ins588 n/a
2 ccsbBroad304_00237 pLX_304 62.1% 32.8% 32.8% V5 0_1ins588 n/a
3 TRCN0000470181 TACTTTTGGCGGTGATTAGGTCTG pLX_317 44.7% 32.8% 32.8% V5 0_1ins588 n/a
Download CSV