Construct: ORF TRCN0000470229
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007526.1_s317c1
- Derived from:
- ccsbBroadEn_01669
- DNA Barcode:
- CTGACCGCTGTTCATAGGTGCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- THRB (7068)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470229
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7068 | THRB | thyroid hormone receptor beta | NM_000461.5 | 100% | 100% | |
| 2 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001128176.3 | 100% | 100% | |
| 3 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001128177.2 | 100% | 100% | |
| 4 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001252634.2 | 100% | 100% | |
| 5 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354708.2 | 100% | 100% | |
| 6 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354709.2 | 100% | 100% | |
| 7 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354710.2 | 100% | 100% | |
| 8 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354711.2 | 100% | 100% | |
| 9 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354712.2 | 100% | 100% | |
| 10 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354713.2 | 100% | 100% | |
| 11 | human | 7068 | THRB | thyroid hormone receptor beta | XM_006713318.3 | 100% | 100% | |
| 12 | human | 7068 | THRB | thyroid hormone receptor beta | XM_011534047.3 | 100% | 100% | |
| 13 | human | 7068 | THRB | thyroid hormone receptor beta | XM_011534050.2 | 100% | 100% | |
| 14 | human | 7068 | THRB | thyroid hormone receptor beta | XM_011534052.2 | 100% | 100% | |
| 15 | human | 7068 | THRB | thyroid hormone receptor beta | XM_017007109.1 | 100% | 100% | |
| 16 | human | 7068 | THRB | thyroid hormone receptor beta | XM_017007111.1 | 100% | 100% | |
| 17 | human | 7068 | THRB | thyroid hormone receptor beta | XM_017007112.1 | 100% | 100% | |
| 18 | human | 7068 | THRB | thyroid hormone receptor beta | XM_024453733.1 | 100% | 100% | |
| 19 | human | 7068 | THRB | thyroid hormone receptor beta | XM_024453734.1 | 100% | 100% | |
| 20 | human | 7068 | THRB | thyroid hormone receptor beta | XM_024453735.1 | 100% | 100% | |
| 21 | human | 7068 | THRB | thyroid hormone receptor beta | XM_024453736.1 | 100% | 100% | |
| 22 | human | 7068 | THRB | thyroid hormone receptor beta | XM_024453737.1 | 100% | 100% | |
| 23 | human | 7068 | THRB | thyroid hormone receptor beta | XM_024453738.1 | 100% | 100% | |
| 24 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354714.2 | 93.2% | 93.2% | 0_1ins93 |
| 25 | human | 7068 | THRB | thyroid hormone receptor beta | NM_001354715.2 | 93.2% | 93.2% | 0_1ins93 |
| 26 | human | 7068 | THRB | thyroid hormone receptor beta | XM_011534053.2 | 93.2% | 93.2% | 0_1ins93 |
| 27 | human | 7068 | THRB | thyroid hormone receptor beta | XM_017007113.1 | 93.2% | 93.2% | 0_1ins93 |
| 28 | mouse | 21834 | Thrb | thyroid hormone receptor beta | NM_001113417.1 | 90.6% | 96.5% | (many diffs) |
| 29 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_006517966.2 | 90.6% | 96.5% | (many diffs) |
| 30 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_006517967.3 | 90.6% | 96.5% | (many diffs) |
| 31 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_006517968.3 | 90.6% | 96.5% | (many diffs) |
| 32 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_006517970.3 | 90.6% | 96.5% | (many diffs) |
| 33 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_006517971.3 | 90.6% | 96.5% | (many diffs) |
| 34 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_006517972.3 | 90.6% | 96.5% | (many diffs) |
| 35 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244737.1 | 90.6% | 96.5% | (many diffs) |
| 36 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244738.2 | 90.6% | 96.5% | (many diffs) |
| 37 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244739.2 | 90.6% | 96.5% | (many diffs) |
| 38 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244740.2 | 90.6% | 96.5% | (many diffs) |
| 39 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244741.2 | 90.6% | 96.5% | (many diffs) |
| 40 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244742.1 | 90.6% | 96.5% | (many diffs) |
| 41 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244743.2 | 90.6% | 96.5% | (many diffs) |
| 42 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_017315946.1 | 90.6% | 96.5% | (many diffs) |
| 43 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_017315947.1 | 90.6% | 96.5% | (many diffs) |
| 44 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_017315948.1 | 89.5% | 95% | (many diffs) |
| 45 | mouse | 21834 | Thrb | thyroid hormone receptor beta | XM_011244745.1 | 84.5% | 91.1% | (many diffs) |
| 46 | mouse | 21834 | Thrb | thyroid hormone receptor beta | NM_009380.3 | 79.5% | 77.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1452
- ORF length:
- 1383
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gactcccaac agtatgacag aaaatggcct tacagcctgg gacaaaccga 121 agcactgtcc agaccgagaa cacgactgga agctagtagg aatgtctgaa gcctgcctac 181 ataggaagag ccattcagag aggcgcagca cgttgaaaaa tgaacagtcg tcgccacatc 241 tcatccagac cacttggact agctcaatat tccatctgga ccatgatgat gtgaacgacc 301 agagtgtctc aagtgcccag accttccaaa cggaggagaa gaaatgtaaa gggtacatcc 361 ccagttactt agacaaggac gagctctgtg tagtgtgtgg tgacaaagcc accgggtatc 421 actaccgctg tatcacgtgt gaaggctgca agggtttctt tagaagaacc attcagaaaa 481 atctccatcc atcctattcc tgtaaatatg aaggaaaatg tgtcatagac aaagtcacgc 541 gaaatcagtg ccaggaatgt cgctttaaga aatgcatcta tgttggcatg gcaacagatt 601 tggtgctgga tgacagcaag aggctggcca agaggaagct gatagaggag aaccgggaga 661 aaagacggcg ggaagagctg cagaagtcca tcgggcacaa gccagagccc acagacgagg 721 aatgggagct catcaaaact gtcaccgaag cccatgtggc gaccaacgcc caaggcagcc 781 actggaagca aaaacggaaa ttcctgccag aagacattgg acaagcacca atagtcaatg 841 ccccagaagg tggaaaggtt gacttggaag ccttcagcca ttttacaaaa atcatcacac 901 cagcaattac cagagtggtg gattttgcca aaaagttgcc tatgttttgt gagctgccat 961 gtgaagacca gatcatcctc ctcaaaggct gctgcatgga gatcatgtcc cttcgcgctg 1021 ctgtgcgcta tgacccagaa agtgagactt taaccttGAA TGGGGAAATG GCAGTGACAC 1081 GGGGCCAGCT GAAAAATGGG GGTCTTGGGG TGGTGTCAGA CGCCATCTTT GACCTGGGCA 1141 TGTCTCTGTC TTCTTTCAAC CTGGATGACA CTGAAGTAGC CCTCCTTCAG GCCGTCCTGC 1201 TGATGTCTTC AGATCGCCCG GGGCTTGCCT GTGTTGAGAG AATAGAAAAG TACCAAGATA 1261 GTTTCCTGCT GGCCTTTGAA CACTATATCA ATTACCGAAA ACACCACGTG ACACACTTTT 1321 GGCCAAAACT CCTGATGAAG GTGACAGATC TGCGGATGAT AGGAGCCTGC CATGCCAGCC 1381 GCTTCCTGCA CATGAAGGTG GAATGCCCCA CAGAACTCTT CCCCCCTTTG TTCTTGGAAG 1441 TGTTCGAGGA TTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1561 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTG ACCGCTGTTC ATAGGTGCCC 1621 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t