Transcript: Mouse XM_017315948.1

PREDICTED: Mus musculus thyroid hormone receptor beta (Thrb), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thrb (21834)
Length:
7890
CDS:
83..1459

Additional Resources:

NCBI RefSeq record:
XM_017315948.1
NBCI Gene record:
Thrb (21834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353680 GTGCCAGGAATGTCGCTTTAA pLKO_005 553 CDS 100% 13.200 9.240 N THRB n/a
2 TRCN0000222371 CCCAGCTATTTAGACAAAGAT pLKO.1 365 CDS 100% 5.625 3.938 N Thrb n/a
3 TRCN0000222373 GCCTTTGAACACTATATCAAT pLKO.1 1277 CDS 100% 5.625 3.938 N Thrb n/a
4 TRCN0000222372 CCATCCATCTTATTCCTGTAA pLKO.1 490 CDS 100% 4.950 3.465 N Thrb n/a
5 TRCN0000222374 GCATCTATGTTGGCATGGCAA pLKO.1 579 CDS 100% 2.640 1.848 N Thrb n/a
6 TRCN0000020344 GCCTGTGTTGAGAGAATAGAA pLKO.1 1232 CDS 100% 5.625 7.875 N THRB n/a
7 TRCN0000330528 GCCTGTGTTGAGAGAATAGAA pLKO_005 1232 CDS 100% 5.625 7.875 N THRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315948.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01669 pDONR223 100% 89.5% 95% None (many diffs) n/a
2 ccsbBroad304_01669 pLX_304 0% 89.5% 95% V5 (many diffs) n/a
3 TRCN0000470229 CTGACCGCTGTTCATAGGTGCCCC pLX_317 28.8% 89.5% 95% V5 (many diffs) n/a
4 TRCN0000488447 TCATTGCCTCAAGCTTGCCTCAAC pLX_317 19.8% 89.5% 95% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV