Construct: ORF TRCN0000470263
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008127.2_s317c1
- Derived from:
- ccsbBroadEn_15048
- DNA Barcode:
- GTATACCTCTGACCACTGATTAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRIB2 (28951)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470263
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 28951 | TRIB2 | tribbles pseudokinase 2 | NM_021643.3 | 100% | 100% | |
2 | human | 28951 | TRIB2 | tribbles pseudokinase 2 | NR_027303.2 | 27.5% | (many diffs) | |
3 | mouse | 217410 | Trib2 | tribbles pseudokinase 2 | NM_144551.5 | 91.6% | 98.2% | (many diffs) |
4 | mouse | 217410 | Trib2 | tribbles pseudokinase 2 | XM_006515054.1 | 91.6% | 98.2% | (many diffs) |
5 | mouse | 217410 | Trib2 | tribbles pseudokinase 2 | XM_006515055.2 | 74.3% | 70.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1095
- ORF length:
- 1029
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa catacacagg tctaccccca tcacaatagc gagatatggg agatcgcgga 121 acaaaaccca ggatttcgaa gagttgtcgt ctataaggtc cgcggagccc agccagagtt 181 tcagcccgaa cctcggctcc ccgagcccgc ccgagactcc gaacttgtcg cattgcgttt 241 cttgtatcgg gaaatactta ttgttggaac ctctggaggg agaccacgtt tttcgtgccg 301 tgcatctgca cagcggagag gagctggtgt gcaaggtgtt tgatatcagc tgctaccagg 361 aatccctggc accgtgcttt tgcctgtctg ctcatagtaa catcaaccaa atcactgaaa 421 ttatcctggg tgagaccaaa gcctatgtgt tctttgagcg aagctatggg gacatgcatt 481 ccttcgtccg cacctgcaag aagctgagag aggaggaggc agccagactg ttctaccaga 541 ttgcctcggc agtggcccac tgccatgacg gggggctggt gctgcgggac ctcaagctgc 601 ggaaattcat ctttaaggac gaagagagga ctcgggtcaa gctggaaagc ctggaagacg 661 cctacattct gcggggagat gatgattccc tctccgacaa gcatggctgc ccggcttacg 721 taagcccaga gatcttGAAC ACCAGTGGCA GCTACTCGGG CAAAGCAGCC GACGTGTGGA 781 GCCTGGGGGT GATGCTGTAC ACCATGTTGG TGGGGCGGTA CCCTTTCCAT GACATTGAAC 841 CCAGCTCCCT CTTCAGCAAG ATCCGGCGTG GCCAGTTCAA CATTCCAGAG ACTCTGTCGC 901 CCAAGGCCAA GTGCCTCATC CGAAGCATTC TGCGTCGGGA GCCCTCAGAG CGGCTGACCT 961 CGCAGGAAAT TCTGGACCAT CCTTGGTTTT CTACAGATTT TAGCGTCTCG AATTCAGCAT 1021 ATGGTGCTAA GGAAGTGTCT GACCAGCTGG TGCCGGACGT CAACATGGAA GAGAACTTGG 1081 ACCCTTTCTT TAACTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1141 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1201 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GTATACCTCT GACCACTGAT 1261 TAGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt